WormBase Tree Display for Variation: WBVar00090860
expand all nodes | collapse all nodes | view schema
WBVar00090860 | Evidence | Paper_evidence | WBPaper00031335 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n4541 | |||||||
Sequence_details | SMap | S_parent | Sequence | C39D10 | |||||
Flanking_sequences | TTGTTGGAGAAATGAATAAA | TCTACAAAATTAGGGAACA | |||||||
Mapping_target | C39D10 | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00027532 | ||||||||
WBStrain00027588 | |||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00255565 | |||||||
WBGene00003334 | |||||||||
WBGene00045343 | |||||||||
Transcript | C39D10.18 | ||||||||
C39D10.12 | |||||||||
C39D10.10 | |||||||||
Interactor | WBInteraction000576759 | ||||||||
WBInteraction000576760 | |||||||||
WBInteraction000576761 | |||||||||
WBInteraction000576762 | |||||||||
WBInteraction000576763 | |||||||||
WBInteraction000576764 | |||||||||
WBInteraction000576765 | |||||||||
WBInteraction000576766 | |||||||||
WBInteraction000576767 | |||||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00031335 | |||||
Genetics | Interpolated_map_position | X | -1.03875 | ||||||
Description | Phenotype | WBPhenotype:0000157 | Paper_evidence | WBPaper00041724 | |||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | The posterior contraction in n4541 mutant worms often appeared to be biphasic, with an initial weak contraction, followed by a full contraction. This was associated with a longer interval between the posterior contraction and subsequent steps in the motor program. | Paper_evidence | WBPaper00041724 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
The posterior contraction in n4541 mutant worms often appeared to be weak and were not associated with a full DMP (defecation motor program). This occurred in 34.6 percent of the worms. | Paper_evidence | WBPaper00041724 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Penetrance | Low | 34.6 percent | Paper_evidence | WBPaper00041724 | |||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000205 | Paper_evidence | WBPaper00041724 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | n4541 mutant worms occasionally failed to execute an enteric muscle contraction and expulsion following a strong posterior body-contraction event. This occurred in 14.8 percent cycles. | Paper_evidence | WBPaper00041724 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Penetrance | Low | Occurred in 14.8 percent of the cycles observed. | Paper_evidence | WBPaper00041724 | |||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000208 | Paper_evidence | WBPaper00031335 | |||||||
WBPaper00041724 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson557 | |||||||||
Remark | Length of defecation cycle is increased | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
n4541 worms display long, arrhythmic defecation cycles, as determined by the length of time between consecutive posterior body-contraction events. The n4541 allele deletes the mir-240/786 micro-RNA cluster, but it was determined through rescue experiments that it was loss of the mir-786 region that causes the phenotype, not the mir-240 region. | Paper_evidence | WBPaper00041724 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000650 | Paper_evidence | WBPaper00041724 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | n4541 worms display long, arrhythmic defecation cycles, as determined by the length of time between consecutive posterior body-contraction events. The n4541 allele deletes the mir-240/786 micro-RNA cluster, but it was determined through rescue experiments that it was loss of the mir-786 region that causes the phenotype, not the mir-240 region. | Paper_evidence | WBPaper00041724 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000994 | Paper_evidence | WBPaper00041724 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | n4541 mutant worms occasionally failed to execute an enteric muscle contraction and expulsion following a strong posterior body-contraction event. This occurred in 14.8 percent of the cycles. | Paper_evidence | WBPaper00041724 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Penetrance | Low | Occurred in 14.8 percent of the cycles observed. | Paper_evidence | WBPaper00041724 | |||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001347 | Paper_evidence | WBPaper00041724 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Causes ectopic intestinal calcium-wave initiation. In wild-type worms, each calcium peak represents a fast intercellular calcium wave that initiates in the posterior intestine and propagates anteriorly. Multiple defects in calcium oscillations were observed in mir-240/786(n4541) mutants. First, calcium oscillations were arrhythmic and differed greatly in magnitude in mir-240/786cmutants (Figure 4C) relative to wild-type controls (Figure 4A). Second, multiple calcium events occurred in each defecation cycle (Figure 4H), with small calcium increases often preceding successively larger calcium increases, until the DMP was triggered (Figures 4C and S1). Third, the spatial pattern of calcium-wave initiation was strikingly altered in mir-240/786 mutants. Whereas, in wild-type worms, calcium-wave initiation is restricted to the anterior and posterior ends of the intestine, calcium-wave initiation in mir-240/786 mutants often occurred at ectopic sites in internal intestinal cells. | Paper_evidence | WBPaper00041724 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Phenotype_assay | Genotype | pha-1(e2123ts) III; him-5(e1490) V; mir-240/786(n4541) X; rnyEx109 [Pnhx-2::D3cpv +pha-1(+)]. | Paper_evidence | WBPaper00041724 | |||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001640 | Paper_evidence | WBPaper00041724 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Acidification of the intestinal cytoplasm results from calcium signaling during defecation and contributes to the behavioral output. In mir-240/786(n4541) worms acidification events were arrhythmic. | Paper_evidence | WBPaper00041724 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Phenotype_assay | Genotype | pha-1(e2123ts) III; mir-240/786 (n4541) X; rnyEx006 [Pnhx-2::pHluorin, pha-1(+)] | Paper_evidence | WBPaper00041724 | |||||
Curator_confirmed | WBPerson557 | ||||||||
Phenotype_not_observed | WBPhenotype:0000006 | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | non-Egl | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000634 | Paper_evidence | WBPaper00031335 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Pumping is normal | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000637 | Paper_evidence | WBPaper00031335 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No defects in dauer formation | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00031335 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | non-Unc | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001233 | Paper_evidence | WBPaper00031335 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Cell number and nuclear staining is normal | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | DAPI staining | Paper_evidence | WBPaper00031335 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00031335 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | non-Dyf | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005666 | PATO:0000460 | Paper_evidence | WBPaper00031335 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005667 | PATO:0000460 | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005668 | PATO:0000460 | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005665 | PATO:0000460 | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005661 | PATO:0000460 | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0007807 | PATO:0000460 | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0007808 | PATO:0000460 | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | DiO staining | Paper_evidence | WBPaper00031335 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00031335 | ||||||||
WBPaper00041724 | |||||||||
Method | Deletion_allele |