WormBase Tree Display for Variation: WBVar00090709
expand all nodes | collapse all nodes | view schema
WBVar00090709 | Evidence | Paper_evidence | WBPaper00032217 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name (3) | |||||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_X | |||||
Flanking_sequences | ttctttcctgactcgaataccttactcagg | tttgtgtgcggggggggactttgttattca | |||||||
Mapping_target | CHROMOSOME_X | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00005829 | ||||||||
WBStrain00047339 | |||||||||
WBStrain00047342 | |||||||||
WBStrain00047343 | |||||||||
WBStrain00047344 | |||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006743 | |||||||
Transcript | Y16B4A.1.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y16B4A.1.1:c.88_563+1del | ||||||||
cDNA_position | 141-? | ||||||||
CDS_position | 88-? | ||||||||
Protein_position | 30-? | ||||||||
Intron_number | 3-6/13 | ||||||||
Exon_number | 3-6/14 | ||||||||
Interactor | WBInteraction000503797 | ||||||||
WBInteraction000503798 | |||||||||
WBInteraction000503799 | |||||||||
Genetics | Interpolated_map_position | X | 21.3167 | ||||||
Description | Phenotype | WBPhenotype:0000099 | Paper_evidence | WBPaper00032217 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The pattern and timeing of divisions were normal. | Paper_evidence | WBPaper00032217 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00032217 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032217 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000134 | Paper_evidence | WBPaper00061878 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The number of cholinergic MNs showing expression of nep-21::RFP, dmsr-2::RFP and D2007.2::RFP is significantly decreased in unc-3(n3435) animals (Figure 1A-C). | Paper_evidence | WBPaper00061878 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005300 | PATO:0000460 | Paper_evidence | WBPaper00061878 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0006840 | PATO:0000460 | Paper_evidence | WBPaper00061878 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000306 | Paper_evidence | WBPaper00032217 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 33 of 50 VB neurons scored at random from the P9 and P10 descendants of 25 L3 unc-3 mutants expressed Punc-4gfp, compared to none of 50 wild-type animals. | Paper_evidence | WBPaper00032217 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00032217 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032217 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005336 | PATO:0000460 | Paper_evidence | WBPaper00032217 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | Punc-4::gfp | Paper_evidence | WBPaper00032217 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00032217 | |||||||
WBPaper00040449 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson15063 | |||||||||
Remark | Uncoordinated movement is indistinguishable from that of e151 or n3412. | Paper_evidence | WBPaper00032217 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00032217 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032217 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | Plin-11::GFP | Paper_evidence | WBPaper00032217 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000816 | Paper_evidence | WBPaper00032217 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Two thirds of the VB motor neurons failed to develop normally as assayed by the altered expression of VB specific marker, Pdel-1::gfp, compared to VB and DB marker, Pacr-5::gfp. The number of embryonic DB motor neurons of L1 animals, was reduced compared to wild-type. By contrast, class D neurons were normal as assayed by expression of class D-specific markers, Punc-47gfp and Punc-25gfp. The number of embryonic DA motor neurons is reduced. | Paper_evidence | WBPaper00032217 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00032217 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032217 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005336 | PATO:0000460 | Paper_evidence | WBPaper00032217 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005274 | PATO:0000460 | Paper_evidence | WBPaper00032217 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005278 | PATO:0000460 | Paper_evidence | WBPaper00032217 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | Punc-4::gfp | Paper_evidence | WBPaper00032217 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001312 | Paper_evidence | WBPaper00032217 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The number of embryonic DA motor neurons is reduced to 1.3 0.2 Punc-4gfp-expressing neurons compared to 2.8 0.3 in otherwise wild-type animals although the ventral nerve cord has a normal number of neuronal nuclei (data not shown). Whereas in L3 animals, the number of Punc-4gfp-expressing neurons is increased to 15.1 0.4 neurons compared to wild-type animals with 10.9 0.3 neurons. | Paper_evidence | WBPaper00032217 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00032217 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032217 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations (2) | |||||||||
Phenotype_assay | Genotype | Punc-4::gfp | Paper_evidence | WBPaper00032217 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002508 | Paper_evidence | WBPaper00032217 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals have three to four extra VC-like neurons (Plin-11::gfp or Pida-1::gfp positive) in the ventral nerve cord of adults as compared to wild-type animals. Extra VC-like neurons were also identified by using an antiserum against FMRFamide. These extra VC-like neurons arise as descendents of Pn.aa. | Paper_evidence | WBPaper00032217 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00032217 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032217 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005304 | PATO:0000460 | Paper_evidence | WBPaper00032217 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | Plin-11::gfp or Pida::gfp | Paper_evidence | WBPaper00032217 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000054 | Paper_evidence | WBPaper00040449 | ||||||
Curator_confirmed | WBPerson15063 | ||||||||
WBPhenotype:0002575 | Paper_evidence | WBPaper00061878 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | We did not detect statistically significant differences in the expression of ncs-2, npr-29, and drn-1 in cholinergic MNs of unc-3(n3435) when compared to wild-type animals (Figure 1D-F). | Paper_evidence | WBPaper00061878 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005300 | PATO:0000460 | Paper_evidence | WBPaper00061878 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0006840 | PATO:0000460 | Paper_evidence | WBPaper00061878 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00040449 | ||||||||
WBPaper00032217 | |||||||||
WBPaper00061878 | |||||||||
Method | Deletion_allele |