WormBase Tree Display for Variation: WBVar00090656
expand all nodes | collapse all nodes | view schema
WBVar00090656 | Evidence | Paper_evidence | WBPaper00002543 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n3091 | |||||||
Other_name | Y71F9B.5a.2:c.163C>T | ||||||||
CE28810:p.Gln55Ter | |||||||||
CE25569:p.Gln55Ter | |||||||||
Y71F9B.5b.1:c.163C>T | |||||||||
Y71F9B.5a.1:c.163C>T | |||||||||
HGVSg | CHROMOSOME_I:g.2708198C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y71F9B | |||||
Flanking_sequences | tatttcccgaataccattctacacaacgat | aacacacggtaagcccccttcaccaataat | |||||||
Mapping_target | Y71F9B | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00002543 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00008495 | ||||||||
WBStrain00027350 | |||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003006 | |||||||
Transcript | Y71F9B.5a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y71F9B.5a.1:c.163C>T | ||||||||
HGVSp | CE25569:p.Gln55Ter | ||||||||
cDNA_position | 193 | ||||||||
CDS_position | 163 | ||||||||
Protein_position | 55 | ||||||||
Exon_number | 3/11 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Y71F9B.5b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y71F9B.5b.1:c.163C>T | ||||||||
HGVSp | CE28810:p.Gln55Ter | ||||||||
cDNA_position | 194 | ||||||||
CDS_position | 163 | ||||||||
Protein_position | 55 | ||||||||
Exon_number | 3/11 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Y71F9B.5a.2 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y71F9B.5a.2:c.163C>T | ||||||||
HGVSp | CE25569:p.Gln55Ter | ||||||||
cDNA_position | 490 | ||||||||
CDS_position | 163 | ||||||||
Protein_position | 55 | ||||||||
Exon_number | 4/12 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor | WBInteraction000500222 | ||||||||
WBInteraction000500223 | |||||||||
WBInteraction000502406 | |||||||||
WBInteraction000502798 | |||||||||
WBInteraction000521878 | |||||||||
WBInteraction000538657 | |||||||||
WBInteraction000538660 | |||||||||
WBInteraction000538734 | |||||||||
WBInteraction000538737 | |||||||||
Genetics | Interpolated_map_position | I | -7.43257 | ||||||
Description | Phenotype | WBPhenotype:0000104 | Paper_evidence | WBPaper00003570 | |||||
WBPaper00004579 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson557 | |||||||||
Remark | Less than 10% of animals exhibit normal asymmetric T cell division polarity. The majority of mutants exhibit symmetric divisions while the remained exhibit reversed polarity. | Paper_evidence | WBPaper00003570 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
In lin-17 animals, which display a loss of T cell polarity, the level of POP-1 was high in both T cell daughters (it is higher in the anterior T cell daughter in wild-type animals). | Paper_evidence | WBPaper00004579 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00003570 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004946 | PATO:0000460 | Paper_evidence | WBPaper00003570 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0004944 | PATO:0000460 | Paper_evidence | WBPaper00003570 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0008409 | PATO:0000460 | Paper_evidence | WBPaper00004579 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000111 | Paper_evidence | WBPaper00004579 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | In lin-17 animals, which display a loss of T cell polarity, the level of POP-1 was high in both T cell daughters (it is higher in the anterior T cell daughter in wild-type animals). | Paper_evidence | WBPaper00004579 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0008409 | PATO:0000460 | Paper_evidence | WBPaper00004579 | ||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000155 | Paper_evidence | WBPaper00003570 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 10% of animals exhibit T cell divisions with reversed polarity. | Paper_evidence | WBPaper00003570 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00003570 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004946 | PATO:0000460 | Paper_evidence | WBPaper00003570 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0004944 | PATO:0000460 | Paper_evidence | WBPaper00003570 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000257 | Paper_evidence | WBPaper00002543 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Adult hermaphrodites exhibited phasmid defects as assayed by DiO dye-filling. | Paper_evidence | WBPaper00002543 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000414 | Paper_evidence | WBPaper00003428 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | The lin-17(n3091) mutation resulted in a transformation of V5.pa fate in V6-ablated animals from seam cells to the postdeirid neuroblast in 33% of animals (Table 2) | Paper_evidence | WBPaper00003428 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
The lin-17(n3091) mutation resulted in a transformation of V5.pa fate in V2,V3,V4-ablated animals from seam cells to the postdeirid neuroblast in 9% of animals (Table 4) | Paper_evidence | WBPaper00003428 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 33% penetrance | Paper_evidence | WBPaper00003428 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Low | 9% penetrance | Paper_evidence | WBPaper00003428 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007447 | PATO:0000460 | Paper_evidence | WBPaper00003428 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0007464 | PATO:0000460 | Paper_evidence | WBPaper00003428 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000469 | Paper_evidence | WBPaper00024898 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00024898 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 21 | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004993 | PATO:0000460 | Paper_evidence | WBPaper00024898 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004086 | PATO:0000460 | Paper_evidence | WBPaper00024898 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | From Table 1 legend: "Because QL descendants sometimes were misplaced anteriorly and at other times were misplaced posteriorly, we present the data for both phenotypes. A QL cell descendant was scored as misplaced anteriorly if its nucleus was anterior to V4.p and misplaced posteriorly if its nucleus was posterior to V5.p. Because they occupy positions near each other, the data for SDQL and PVM were combined." | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000828 | Paper_evidence | WBPaper00026860 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 3 | Paper_evidence | WBPaper00026860 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 78 | Paper_evidence | WBPaper00026860 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004946 | PATO:0000460 | Paper_evidence | WBPaper00026860 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004944 | PATO:0000460 | Paper_evidence | WBPaper00026860 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00026860 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We first confirmed that the expression of RNT-1::GFP has resumed in the T.ap cells in most (90%) of the 60 wild-type animals examined (Fig. 6C). In both lin-17 and lin-44 mutants, the expression pattern of RNT-1::GFP was indistinguishable from that of wild-type until the middle L1 stage. rnt-1 appeared to be unresponsive to the Wnt signaling up to this stage. Subsequently, however, lin-17 and lin-44 mutants began to show irregular expressions of RNT-1::GFP among the granddaughter cells. In the analysis of the lin-17 mutation, we examined 50 animals in which the T cell underwent symmetrical cell division giving rise to four hypodermal descendants (Figs. 6A, C). Only 14 animals (28%) showed a normal pattern of RNT-1::GFP expression (detectable in T.ap alone), whereas the great majority (72% in total) exhibited either aberrant expression in various cell combinations such as T.ap and T.pa or T.aa and T.pa, etc. (38%), or no expression at all in any of the four granddaughters (34%)." | Paper_evidence | WBPaper00026860 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004946 | PATO:0000460 | Paper_evidence | WBPaper00026860 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004944 | PATO:0000460 | Paper_evidence | WBPaper00026860 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | RNT-1::GFP | Paper_evidence | WBPaper00026860 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001375 | Paper_evidence | WBPaper00003428 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | lin-17(n3091) resulted in a complete loss of mab-5::GFP expression from the muIs16 transgene in V5.pa and V5.pp cells following ablation of V6 cells (Table 2) | Paper_evidence | WBPaper00003428 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00003428 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007447 | PATO:0000460 | Paper_evidence | WBPaper00003428 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0007464 | PATO:0000460 | Paper_evidence | WBPaper00003428 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0007452 | PATO:0000460 | Paper_evidence | WBPaper00003428 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0007469 | PATO:0000460 | Paper_evidence | WBPaper00003428 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | muIs16 [mab-5::GFP] | Paper_evidence | WBPaper00003428 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001585 | Paper_evidence | WBPaper00026860 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 3 | Paper_evidence | WBPaper00026860 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 78 | Paper_evidence | WBPaper00026860 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004946 | PATO:0000460 | Paper_evidence | WBPaper00026860 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004944 | PATO:0000460 | Paper_evidence | WBPaper00026860 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed (6) | |||||||||
Reference | WBPaper00004579 | ||||||||
WBPaper00024898 | |||||||||
WBPaper00003428 | |||||||||
WBPaper00006052 | |||||||||
WBPaper00003570 | |||||||||
WBPaper00026860 | |||||||||
WBPaper00002543 | |||||||||
Method | Substitution_allele |