WormBase Tree Display for Variation: WBVar00090268
expand all nodes | collapse all nodes | view schema
WBVar00090268 | Evidence | Paper_evidence | WBPaper00025002 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n1812 | |||||||
Other_name | CE24779:p.Glu28Ter | ||||||||
C02F4.1.1:c.82G>T | |||||||||
HGVSg | CHROMOSOME_IV:g.10484249G>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | F01D4 | |||||
Flanking_sequences | ccgcttccatcttgtgatgctccacgatta | aactttttattggcgatcgaatatgtgttt | |||||||
Mapping_target | F01D4 | ||||||||
Type_of_mutation | Substitution | g | t | Paper_evidence | WBPaper00025002 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00027132 | ||||||||
WBStrain00027134 | |||||||||
WBStrain00027167 | |||||||||
WBStrain00027342 | |||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000419 | |||||||
Transcript | C02F4.1.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C02F4.1.1:c.82G>T | ||||||||
HGVSp | CE24779:p.Glu28Ter | ||||||||
cDNA_position | 97 | ||||||||
CDS_position | 82 | ||||||||
Protein_position | 28 | ||||||||
Exon_number | 3/21 | ||||||||
Codon_change | Gaa/Taa | ||||||||
Amino_acid_change | E/* | ||||||||
Interactor (32) | |||||||||
Genetics | Interpolated_map_position | IV | 4.60586 | ||||||
Mapping_data | In_multi_point | 1517 | |||||||
1518 | |||||||||
1520 | |||||||||
1521 | |||||||||
1522 | |||||||||
1523 | |||||||||
1820 | |||||||||
1822 | |||||||||
In_pos_neg_data | 4243 | ||||||||
Description | Phenotype (13) | ||||||||
Phenotype_not_observed | WBPhenotype:0000047 | Paper_evidence | WBPaper00038341 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Endodermal precursors became internalized at the 2E stage, as in wild-type embryos. | Ea/Ep internalize successfully in a likely null allele of ced-5, n1812. | Paper_evidence | WBPaper00038341 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000072 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | no gross phenotype | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000631 | Paper_evidence | WBPaper00035198 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals do not exhibit anterior convulsions when treated with pentylenetetrazole(PTZ). | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004251 | Paper_evidence | WBPaper00035198 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00004883 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001656 | Paper_evidence | WBPaper00003948 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Initiating and maintaining a trajectory is normal. | Paper_evidence | WBPaper00003948 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002067 | Paper_evidence | WBPaper00040757 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Closure speed in apical cell areas in ced-5(n1812) does not reach the speed found in wild-type embryos. | Paper_evidence | WBPaper00040757 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002486 | Paper_evidence | WBPaper00050421 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Mutations in genes within the ced-1/6/7 pathway (ced-1, ced-7, nrf-5, ttr-52), the ced-2/5/12 pathway (ced-2, ced-5), or both pathways (ced-1;ced-2 and ced-7;ced-5) did not cause PGC lobes to persist in L1 larvae (Supplementary Table 1), indicating that ced-10 functions in PGC lobe scission in a different context than it does in cell corpse engulfment." (PGC = 'primordial germ cell') | Paper_evidence | WBPaper00050421 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Predicted_null_via_sequence | Paper_evidence | WBPaper00050421 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004576 | PATO:0000460 | Paper_evidence | WBPaper00050421 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004575 | PATO:0000460 | Paper_evidence | WBPaper00050421 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00050421 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | All strains include the xnIs360 or xnSi1 transgenes to visualize PGC membranes. | Paper_evidence | WBPaper00050421 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference (23) | |||||||||
Method | Substitution_allele |