WormBase Tree Display for Variation: WBVar00090266
expand all nodes | collapse all nodes | view schema
| WBVar00090266 | Evidence | Paper_evidence | WBPaper00001105 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | n1810 | |||||||
| Other_name | F53B2.6.1:c.140G>A | ||||||||
| CE17851:p.Gly47Asp | |||||||||
| HGVSg | CHROMOSOME_IV:g.12542432G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | F53B2 | |||||
| Flanking_sequences | cttcggcgtgcgagtcgatcacttacatgg | cttcatgcgcccgggcaccctattcgtgtc | |||||||
| Mapping_target | F53B2 | ||||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00026623 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Laboratory | MT | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00001820 | |||||||
| Transcript | F53B2.6.1 (12) | ||||||||
| Genetics | Interpolated_map_position | IV | 6.01713 | ||||||
| Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00001105 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Penetrance | Incomplete | Paper_evidence | WBPaper00001105 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Range | 40 | 40 | Paper_evidence | WBPaper00001105 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001105 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000257 | Paper_evidence | WBPaper00001105 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | PHBs are dye filling defective in ham-1 mutants | Paper_evidence | WBPaper00001105 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0007808 | PATO:0000460 | Paper_evidence | WBPaper00001105 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000414 | Paper_evidence | WBPaper00001105 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | ham-1 mutants have extra HSN-like cells. Authors comment that these extra cells are most likely the PHBs and suggest that the PHB fate may be variably transformed to the HSN fate | Paper_evidence | WBPaper00001105 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000425 | Paper_evidence | WBPaper00001105 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Serotonin levels are reduced in HSNs (determined immunocytochemically). | Paper_evidence | WBPaper00001105 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00001105 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001105 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000470 | Paper_evidence | WBPaper00001105 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | HSNs fail to arrive at their final destination (between P5/6 and V4) | Paper_evidence | WBPaper00001105 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00001105 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00001105 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Reference | WBPaper00001105 | ||||||||
| Method | Substitution_allele |
