WormBase Tree Display for Variation: WBVar00090170
expand all nodes | collapse all nodes | view schema
WBVar00090170 | Evidence | Paper_evidence | WBPaper00032921 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | n1439 | |||||
Other_name | C08C3.7:n.11_41delinsATTTTGGAATGTTCCAGAACTTTCTAGAAAAATCGAGAAA | ||||||
HGVSg | CHROMOSOME_III:g.7800655_7800685delinsTTTCTCGATTTTTCTAGAAAGTTCTGGAACATTCCAAAAT | ||||||
Sequence_details | SMap | S_parent | Sequence | C08C3 | |||
Flanking_sequences | ctgttaatatttttacgagccattgtattat | aacggagaatcattttaaattttttgttgtt | |||||
Mapping_target | C08C3 | ||||||
Type_of_mutation | Insertion | tttctcgatttttctagaaagttctggaacattccaaaat | |||||
Deletion | ggaacccggtgttattatgattgttattaac | ||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | MT | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00196265 | |||||
Transcript | C08C3.7 | VEP_consequence | non_coding_transcript_exon_variant | ||||
VEP_impact | MODIFIER | ||||||
HGVSc | C08C3.7:n.11_41delinsATTTTGGAATGTTCCAGAACTTTCTAGAAAAATCGAGAAA | ||||||
cDNA_position | 11-41 | ||||||
Exon_number | 1/1 | ||||||
Genetics | Interpolated_map_position | III | -0.586327 | ||||
Mapping_data | In_multi_point | 1397 | |||||
1494 | |||||||
Description | Phenotype (6) | ||||||
Phenotype_not_observed | WBPhenotype:0001414 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Remark | weakest allele, males can mate | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00014215 | ||||||
WBPaper00013781 | |||||||
WBPaper00001105 | |||||||
WBPaper00001133 | |||||||
WBPaper00013865 | |||||||
WBPaper00018228 | |||||||
Remark | n1439 contains an ~800bp insertion of a tandem repeat (19 near-identical copies of a 40 base repeat element-shown above) and a deletion of 37 bp at the insertion site, both ~13.8 kb upstream of the egl-5 coding region. | ||||||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00001174 Genomic_neighbourhood | |||||||
Method | Deletion_and_insertion_allele |