WormBase Tree Display for Variation: WBVar00090093
expand all nodes | collapse all nodes | view schema
| WBVar00090093 | Evidence | Paper_evidence | WBPaper00003815 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | n1286 | |||||||
| Other_name | CE29088:p.Trp428Ter | ||||||||
| CE44550:p.Trp212Ter | |||||||||
| C48D1.2a.1:c.1284G>A | |||||||||
| C48D1.2b.1:c.636G>A | |||||||||
| HGVSg | CHROMOSOME_IV:g.13199934C>T | ||||||||
| Sequence_details | SMap | S_parent | Sequence | C48D1 | |||||
| Flanking_sequences | atacgcaacgacagctcaatatgtttcgtg | agaaacagtgctcgtggatcatggttcatt | |||||||
| Mapping_target | C48D1 | ||||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003815 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00027024 | ||||||||
| WBStrain00055847 | |||||||||
| Laboratory | MT | ||||||||
| COP | |||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00000417 | |||||||
| Transcript | C48D1.2a.1 | VEP_consequence | stop_gained | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | C48D1.2a.1:c.1284G>A | ||||||||
| HGVSp | CE29088:p.Trp428Ter | ||||||||
| cDNA_position | 1355 | ||||||||
| CDS_position | 1284 | ||||||||
| Protein_position | 428 | ||||||||
| Exon_number | 8/10 | ||||||||
| Codon_change | tgG/tgA | ||||||||
| Amino_acid_change | W/* | ||||||||
| C48D1.2b.1 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | C48D1.2b.1:c.636G>A | ||||||||
| HGVSp | CE44550:p.Trp212Ter | ||||||||
| cDNA_position | 636 | ||||||||
| CDS_position | 636 | ||||||||
| Protein_position | 212 | ||||||||
| Exon_number | 4/5 | ||||||||
| Codon_change | tgG/tgA | ||||||||
| Amino_acid_change | W/* | ||||||||
| Interactor | WBInteraction000002860 | ||||||||
| WBInteraction000518847 | |||||||||
| WBInteraction000524590 | |||||||||
| Genetics | Interpolated_map_position | IV | 8.46214 | ||||||
| Description | Phenotype | WBPhenotype:0001271 | Paper_evidence | WBPaper00004574 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | ced-3 mutants are hypersusceptible to S. typhimurium-mediated killing. ced-3 mutants died much more quickly than wild-type worms when feeding on S. typhimurium, but died at the same rate as wild-type worms when feeding on E. coli. | Paper_evidence | WBPaper00004574 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0002596 | Paper_evidence | WBPaper00052970 | |||||||
| Curator_confirmed | WBPerson10038 | ||||||||
| Remark | Quoted from paper, "In both ced-3 single and daf-16; ced-3 double mutants the post-deprivation reduction in brood size was eliminated; i.e., the egg-laying dynamics of deprived, control, and unperturbed animals were indistinguishable (Fig. 7a)." | Paper_evidence | WBPaper00052970 | ||||||
| Curator_confirmed | WBPerson10038 | ||||||||
| EQ_annotations | GO_term | GO:0030431 | PATO:0000460 | Paper_evidence | WBPaper00052970 | ||||
| Curator_confirmed | WBPerson10038 | ||||||||
| Reference | WBPaper00003815 | ||||||||
| WBPaper00004574 | |||||||||
| WBPaper00052970 | |||||||||
| WBPaper00065759 | |||||||||
| Method | Substitution_allele |
