WormBase Tree Display for Variation: WBVar00090010
expand all nodes | collapse all nodes | view schema
WBVar00090010 | Evidence | Paper_evidence | WBPaper00003764 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n1186 | |||||||
Other_name (27) | |||||||||
HGVSg | CHROMOSOME_IV:g.10339043G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | K11E8 | |||||
Flanking_sequences | gagagggaagccagaatttgcagaaaactc | agcatccaaatattgttagactacacgaca | |||||||
Mapping_target | K11E8 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00003764 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00026985 | ||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Linked_to | WBVar00089555 | ||||||||
Affects | Gene | WBGene00006779 | |||||||
Transcript (17) | |||||||||
Interactor | WBInteraction000052105 | ||||||||
WBInteraction000501679 | |||||||||
WBInteraction000501730 | |||||||||
Genetics | Interpolated_map_position | IV | 4.57623 | ||||||
Description | Phenotype | WBPhenotype:0000016 | Paper_evidence | WBPaper00031872 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | % animals paralyzed after 60 min on 1mM aldicarb was significantly higher than % N2 animals paralyzed. | Paper_evidence | WBPaper00031872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00031872 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007833 | PATO:0001549 | Paper_evidence | WBPaper00031872 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000180 | Paper_evidence | WBPaper00031872 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The intensity of GFP::SNB-1 axonal fluorescence was significantly lower than that observed in wild-type. | Paper_evidence | WBPaper00031872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005190 | PATO:0000460 | Paper_evidence | WBPaper00031872 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | juIs1 | Paper_evidence | WBPaper00031872 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000655 | Paper_evidence | WBPaper00031872 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Rate and amplitude of endogenous IPSCs were significantly decreased compared to wild-type although the shape of the average IPSC was identical to wild-type. | Paper_evidence | WBPaper00031872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001316 | Paper_evidence | WBPaper00031872 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Muscimol activated current was significantly less than that observed for wild type animals. | Paper_evidence | WBPaper00031872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001319 | Paper_evidence | WBPaper00031872 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Rate of endogenous IPSCs were decreased 77% compared to wild-type. | Paper_evidence | WBPaper00031872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001320 | Paper_evidence | WBPaper00031872 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The amplitude of endogenous IPSCs were decreased 36% compared to wild-type controls. | Paper_evidence | WBPaper00031872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001512 | Paper_evidence | WBPaper00029404 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals express str-2::GFP in both AWC cells, e.g. both AWC neurons are AWC on (n=216). | Paper_evidence | WBPaper00029404 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00029404 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00029404 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005672 | PATO:0000460 | Paper_evidence | WBPaper00029404 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005832 | PATO:0000460 | Paper_evidence | WBPaper00029404 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005833 | PATO:0000460 | Paper_evidence | WBPaper00029404 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | str-2::GFP | Paper_evidence | WBPaper00029404 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001661 | Paper_evidence | WBPaper00003760 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants are defective in str-2 asymmetry | Paper_evidence | WBPaper00003760 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00003760 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005672 | PATO:0000460 | Paper_evidence | WBPaper00003760 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001685 | Paper_evidence | WBPaper00031872 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Number of post-synaptic GFP-tagged UNC-49 GABAAR::GFP puncta was decreased compared to wild type | Paper_evidence | WBPaper00031872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | GFP-tagged GABAAR | Paper_evidence | WBPaper00031872 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000616 | Paper_evidence | WBPaper00031872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The alignment of the pre (RFP-tagged RAB-3) and post synaptic (GFP-tagged UNC-49) components was unaltered. | Paper_evidence | WBPaper00031872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005190 | PATO:0000460 | Paper_evidence | WBPaper00031872 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | oxIs22; nuIs283 | Paper_evidence | WBPaper00031872 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000656 | Paper_evidence | WBPaper00031872 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Rate and amplitude of endogenous EPSCs were comparable to wild-type. | Paper_evidence | WBPaper00031872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000847 | Paper_evidence | WBPaper00031872 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The density of GFP::SNB-1 puncta in GABAergic and cholinergic axons was not significantly different from wild-type. | Paper_evidence | WBPaper00031872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | nuIs152 or juIs1 | Paper_evidence | WBPaper00031872 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001013 | Paper_evidence | WBPaper00005370 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals were found to have no Esp killing response to PA14. | Paper_evidence | WBPaper00005370 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00005370 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Approximately 25 L4-stage worms were placed on each of three agar plates with PA14 lawns under standard slow killing (SK) assay conditions. Survival was assayed after 30 hours. | Paper_evidence | WBPaper00005370 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00003760 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | gcy-5 was asymmetrically expressed only in ASER in unc-43 mutants | Paper_evidence | WBPaper00003760 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00003760 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0002199 | Paper_evidence | WBPaper00049050 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "However, neither crh-1 mutants that lacked a C. elegans CREB homolog (Nishida et al., 2011) nor unc-43 mutants that lacked the C. elegans CaMKII ortholog (Reiner et al., 1999) showed a severe defect in the variable calcium response of AFD (Figure S2B)." | Paper_evidence | WBPaper00049050 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005662 | PATO:0000460 | Paper_evidence | WBPaper00049050 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | njIs24[gcy-8p::GCaMP3, gcy-8p::TagRFP] (I); Parent strain: IK1286 | Paper_evidence | WBPaper00049050 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00031872 | ||||||||
WBPaper00003760 | |||||||||
WBPaper00005370 | |||||||||
WBPaper00029404 | |||||||||
WBPaper00049050 | |||||||||
Method | Substitution_allele |