WormBase Tree Display for Variation: WBVar00089924
expand all nodes | collapse all nodes | view schema
WBVar00089924 | Name | Public_name | n1051 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | CE44782:p.Trp69Ter | ||||||||
C16B8.1.1:c.206G>A | |||||||||
HGVSg | CHROMOSOME_X:g.3958946G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | C16B8 | |||||
Flanking_sequences | tggcaaacatcgactacctctcgttcacat | gaatgctgttggaattgtaataaaaacata | |||||||
Mapping_target | C16B8 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00024383 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00026934 | ||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003007 | |||||||
Transcript | C16B8.1.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C16B8.1.1:c.206G>A | ||||||||
HGVSp | CE44782:p.Trp69Ter | ||||||||
cDNA_position | 214 | ||||||||
CDS_position | 206 | ||||||||
Protein_position | 69 | ||||||||
Exon_number | 3/14 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
Interactor | WBInteraction000524380 | ||||||||
WBInteraction000534754 | |||||||||
Genetics | Interpolated_map_position | X | -8.87019 | ||||||
Description | Phenotype | WBPhenotype:0000220 | Paper_evidence | WBPaper00024693 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Vulva cell fate specification was abnormal as indicated by the expression patterns of the cdh-3::CFP and ceh-2::YFP transgenes (Figure 5) | Paper_evidence | WBPaper00024693 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004448 | PATO:0000460 | Paper_evidence | WBPaper00024693 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004447 | PATO:0000460 | Paper_evidence | WBPaper00024693 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004436 | PATO:0000460 | Paper_evidence | WBPaper00024693 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004435 | PATO:0000460 | Paper_evidence | WBPaper00024693 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004434 | PATO:0000460 | Paper_evidence | WBPaper00024693 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004433 | PATO:0000460 | Paper_evidence | WBPaper00024693 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004432 | PATO:0000460 | Paper_evidence | WBPaper00024693 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000695 | Paper_evidence | WBPaper00024693 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Figure 5 | Paper_evidence | WBPaper00024693 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000700 | Paper_evidence | WBPaper00000762 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Single protrusion posterior to the vulva. | Paper_evidence | WBPaper00000762 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00000762 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00000762 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00000762 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | |||||||||
WBPhenotype:0002011 | Paper_evidence | WBPaper00024693 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Figure 5 | Paper_evidence | WBPaper00024693 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002193 | Paper_evidence | WBPaper00024693 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "In wild type, vulA cells arise from the posterior daughter of P7.p (P7.pp). However, in lin-17(-), lin-18(-), and in double mutants, vulA cells most commonly arose from the anterior daughter of P7.p (P7.pa). This pattern of vulA specification suggests a reversal in the P7.p lineage at the first round of cell division." (Figure 5, Table 3) | Paper_evidence | WBPaper00024693 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004434 | PATO:0000460 | Paper_evidence | WBPaper00024693 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004435 | PATO:0000460 | Paper_evidence | WBPaper00024693 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004432 | PATO:0000460 | Paper_evidence | WBPaper00024693 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004433 | PATO:0000460 | Paper_evidence | WBPaper00024693 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004436 | PATO:0000460 | Paper_evidence | WBPaper00024693 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004447 | PATO:0000460 | Paper_evidence | WBPaper00024693 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004448 | PATO:0000460 | Paper_evidence | WBPaper00024693 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0001235 | Paper_evidence | WBPaper00004436 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Animals exhibited wild type V5 cell division polarity (Table 2) | Paper_evidence | WBPaper00004436 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004890 | PATO:0000460 | Paper_evidence | WBPaper00004436 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004876 | PATO:0000460 | Paper_evidence | WBPaper00004436 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004250 | PATO:0000460 | Paper_evidence | WBPaper00004436 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0007446 | PATO:0000460 | Paper_evidence | WBPaper00004436 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004246 | PATO:0000460 | Paper_evidence | WBPaper00004436 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0007463 | PATO:0000460 | Paper_evidence | WBPaper00004436 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00004436 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00004436 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00004436 | ||||||||
WBPaper00000762 | |||||||||
WBPaper00024693 | |||||||||
WBPaper00023511 | |||||||||
Method | Substitution_allele |