WormBase Tree Display for Variation: WBVar00089843
expand all nodes | collapse all nodes | view schema
| WBVar00089843 | Evidence | Paper_evidence | WBPaper00003577 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | n941 | |||||||
| Sequence_details | Flanking_sequences | atcttgacacatattcaatggctcgtcaca | atttcccaccgaatccacgtgcacaatcgc | ||||||
| Mapping_target | R107 | ||||||||
| Type_of_mutation | Substitution | g | a | Person_evidence | WBPerson43842 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00022547 | ||||||||
| WBStrain00026915 | |||||||||
| Laboratory | MT | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00003001 | |||||||
| Interactor | WBInteraction000500651 | ||||||||
| WBInteraction000503581 | |||||||||
| WBInteraction000503583 | |||||||||
| WBInteraction000518468 | |||||||||
| WBInteraction000541748 | |||||||||
| Description | Phenotype (14) | ||||||||
| Phenotype_not_observed | WBPhenotype:0000412 | Paper_evidence | WBPaper00038400 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Animals responded robustly to octanol. | Paper_evidence | WBPaper00038400 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Variation_effect | Null | Paper_evidence | WBPaper00038400 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Affected_by | Molecule | WBMol:00001966 | Paper_evidence | WBPaper00038400 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000414 | Paper_evidence | WBPaper00004662 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "We studied P11/12 in lin-12 mutants (glp-1 mutants die as young L1 larvae before P cell migration). P11 and P12 fates are not affected in any of the mutants (or only slightly for lin-12(n676n930); Table 1C and Greenwald et_al, 1983)." | Paper_evidence | WBPaper00004662 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0004409 | PATO:0000460 | Paper_evidence | WBPaper00004662 | ||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | No disruption of ASE asymmetry (as seen with lim-6, gcy-7 and gcy-5 reporters) | Paper_evidence | WBPaper00006052 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Null | Paper_evidence | WBPaper00006052 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Genotype | otIs114, otIs6, otIs3, ntIs1 | Paper_evidence | WBPaper00006052 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Reference (14) | |||||||||
| Remark | n941 is either a W(400) to amber or W(400) to opal mutation | Paper_evidence | WBPaper00003577 | ||||||
| Sequenced by Francesca Coraggio and submitted to WormBase. This mutation is a W(400) to amber mutation. | Person_evidence | WBPerson43842 | |||||||
| Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00003001 Amber_UAG W(400) to stop | Paper_evidence | WBPaper00003577 | |||||||
| Flanks converted to match positive strand. | Curator_confirmed | WBPerson51134 | |||||||
| Method | Substitution_allele |
