WormBase Tree Display for Variation: WBVar00089738
expand all nodes | collapse all nodes | view schema
WBVar00089738 | Evidence | Paper_evidence | WBPaper00001949 | ||
---|---|---|---|---|---|
Name | Public_name | n767 | |||
Other_name | ZK678.1.1:c.994_1113delinsAAAAAAAAAAAA | ||||
CE15383:p.Arg332_Ter371delinsLysLysLysLys | |||||
HGVSg | CHROMOSOME_X:g.15734038_15734215delinsAAAAAAAAAAAA | ||||
Sequence_details | SMap | S_parent | Sequence | ZK678 | |
Flanking_sequences | tcattcaagaattccattaaatcttattac | aatcataatcttagcctcagtgatgctgat | |||
Mapping_target | ZK678 | ||||
Type_of_mutation (2) | |||||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00026879 | ||||
WBStrain00026900 | |||||
WBStrain00027237 | |||||
WBStrain00027359 | |||||
WBStrain00027374 | |||||
WBStrain00027399 | |||||
WBStrain00027524 | |||||
WBStrain00027555 | |||||
WBStrain00027561 | |||||
Laboratory | MT | ||||
Status | Live | ||||
Linked_to | WBVar02143804 | ||||
Affects | Gene | WBGene00023498 | |||
Transcript | ZK678.1.1 (11) | ||||
Interactor (112) | |||||
Genetics | Interpolated_map_position | X | 22.9461 | ||
Mapping_data | In_multi_point | 2660 | |||
Description (2) | |||||
Reference (20) | |||||
Remark | In addition to the deletion and insertion described, allele n767 is comprised of an insertion of an A after the 6th base of the initial insertion and a G to A substitution at the 19th base after this second insertion. | Paper_evidence | WBPaper00001949 | ||
Method | Deletion_and_insertion_allele |