WormBase Tree Display for Variation: WBVar00089719
expand all nodes | collapse all nodes | view schema
WBVar00089719 | Evidence | Paper_evidence | WBPaper00003329 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n745 | |||||||
Other_name | CE24823:p.Trp151Ter | ||||||||
C32F10.2.1:c.453G>A | |||||||||
HGVSg | CHROMOSOME_I:g.5812049G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | C32F10 | |||||
Flanking_sequences | tttaccaaatgacattgttactggtgcatg | gaaacgtacaaccacgcggttcaacgggtt | |||||||
Mapping_target | C32F10 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003329 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (11) | |||||||||
Component_of_genotype | WBGenotype00000009 | ||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003020 | |||||||
Transcript | C32F10.2.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C32F10.2.1:c.453G>A | ||||||||
HGVSp | CE24823:p.Trp151Ter | ||||||||
cDNA_position | 474 | ||||||||
CDS_position | 453 | ||||||||
Protein_position | 151 | ||||||||
Exon_number | 5/12 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
Interactor (52) | |||||||||
Genetics | Interpolated_map_position | I | 0.461844 | ||||||
Mapping_data | In_multi_point | 283 | |||||||
308 | |||||||||
309 | |||||||||
Description | Phenotype | WBPhenotype:0000059 | Paper_evidence | WBPaper00038168 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals show larval arrest at 26 deg C. | Paper_evidence | WBPaper00038168 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 26 | Paper_evidence | WBPaper00038168 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000457 | Paper_evidence | WBPaper00048637 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants have a significantly reduced L1 starvation survival rate compared to controls. | Paper_evidence | WBPaper00048637 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Rescued_by_transgene | WBTransgene00006433 | ||||||||
WBTransgene00021435 | |||||||||
EQ_annotations | Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00048637 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000717 | Paper_evidence | WBPaper00050199 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | "...we observed the derepression of polh-1 and dna-2, two canonical DRM-repressed genes (Fig.6A), in lin-35(n745) mutant animals but did not see any significant change in expression of the HSF-1 developmentallyregulated genes cct-5, sti-1, hsc70 (hsp-1), or hsp90 (daf-21) (Fig. 6B)." | Paper_evidence | WBPaper00050199 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00050199 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000027 | PATO:0000460 | Paper_evidence | WBPaper00050199 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001171 | Paper_evidence | WBPaper00049368 | |||||||
Curator_confirmed | WBPerson632 | ||||||||
WBPhenotype:0001258 | Paper_evidence | WBPaper00027135 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Show increased strength and penetrance for many germline, embryonic, and postembryonic RNAi phenotypes, including neuronal RNAi phenotypes. | Paper_evidence | WBPaper00027135 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001276 | Paper_evidence | WBPaper00046889 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Mutation caused ectopic accumulation of GFP::PGL-1 granules in somatic cells. | Paper_evidence | WBPaper00046889 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001384 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | almost WT alone (reduced fertility); Muv (extra vulval differentiation) in homozygotes with lin-8, lin-38 or lin-15(n767). ES2 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001593 | Paper_evidence | WBPaper00046889 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Authors found that expression of SCM::GFP was significantly reduced. | Paper_evidence | WBPaper00046889 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001595 | Paper_evidence | WBPaper00027135 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Enhanced somatic transgene silencing. | Paper_evidence | WBPaper00027135 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Phenotype_not_observed | WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants respond normally to CO2 | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Disease_info | Models_disease | DOID:1059 | |||||||
Models_disease_in_annotation | WBDOannot00001021 | ||||||||
Reference (17) | |||||||||
Method | Substitution_allele |