WormBase Tree Display for Variation: WBVar00089674
expand all nodes | collapse all nodes | view schema
WBVar00089674 | Evidence | Paper_evidence | WBPaper00002466 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | n686 | |||||
Other_name | M01D7.7b.1:c.438-1G>A | ||||||
M01D7.7a.1:c.594-1G>A | |||||||
HGVSg | CHROMOSOME_I:g.1839250G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | M01D7 | |||
Flanking_sequences | cattcaaaaaacggaaaattgtgttttcca | aatggtggacgtcggaggtcagcgatcaga | |||||
Mapping_target | M01D7 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002466 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00022472 | ||||||
WBStrain00026844 | |||||||
Laboratory | MT | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00001196 | |||||
Transcript (2) | |||||||
Interactor | WBInteraction000503446 | ||||||
WBInteraction000517563 | |||||||
WBInteraction000517571 | |||||||
WBInteraction000518669 | |||||||
WBInteraction000520751 | |||||||
WBInteraction000524573 | |||||||
WBInteraction000542452 | |||||||
Genetics | Interpolated_map_position | I | -12.5532 | ||||
Mapping_data | In_2_point | 736 | |||||
In_multi_point | 634 | ||||||
In_pos_neg_data | 3968 | ||||||
3976 | |||||||
3986 | |||||||
3994 | |||||||
4003 | |||||||
4087 | |||||||
6277 | |||||||
Description | Phenotype (21) | ||||||
Phenotype_not_observed | WBPhenotype:0000436 | Paper_evidence | WBPaper00040857 | ||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Mutations in egl-30 did not cause SNB-1::VENUS localization defects. | Paper_evidence | WBPaper00040857 | ||||
Curator_confirmed | WBPerson712 | ||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00040857 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference (15) | |||||||
Remark | Created by WBPerson51134 from the NN_VFP_triage_pipeline | ||||||
Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||||
Method | Substitution_allele |