WormBase Tree Display for Variation: WBVar00089659
expand all nodes | collapse all nodes | view schema
WBVar00089659 | Evidence | Paper_evidence | WBPaper00002543 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n671 | |||||||
Other_name (7) | |||||||||
HGVSg | CHROMOSOME_I:g.2714848C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y71F9B | |||||
Flanking_sequences | tgtcaatgctataaattcatgattctcacc | aatggacccgaatgacaattgactgtaaac | |||||||
Mapping_target | Y71F9B | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00002543 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00008499 | ||||||||
WBStrain00008500 | |||||||||
WBStrain00008502 | |||||||||
WBStrain00024033 | |||||||||
WBStrain00026829 | |||||||||
WBStrain00026967 | |||||||||
WBStrain00027093 | |||||||||
WBStrain00027149 | |||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects (3) | |||||||||
Genetics | Interpolated_map_position | I | -7.32074 | ||||||
Mapping_data | In_2_point | 3196 | |||||||
7005 | |||||||||
7006 | |||||||||
In_multi_point | 414 | ||||||||
1044 | |||||||||
1045 | |||||||||
1050 | |||||||||
2206 | |||||||||
2207 | |||||||||
3030 | |||||||||
3200 | |||||||||
3435 | |||||||||
In_pos_neg_data | 4081 | ||||||||
4354 | |||||||||
5696 | |||||||||
6234 | |||||||||
6577 | |||||||||
6630 | |||||||||
6640 | |||||||||
Description | Phenotype (35) | ||||||||
Phenotype_not_observed | WBPhenotype:0000218 | Paper_evidence | WBPaper00031110 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No significant number of overinduced animals (worms with greater than three VPCs induced) were detected. | Paper_evidence | WBPaper00031110 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031110 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000219 | Paper_evidence | WBPaper00031110 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No underinduced animals (worms with fewer than 22 vulval cells or fewer than three VPCs induced) were detected. | Paper_evidence | WBPaper00031110 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031110 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000239 | Paper_evidence | WBPaper00004481 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Among the pairs of inner and outer P6.pxxx cells that adopted different fates in AC ablated wild-type animals, RAS(dn) induced animals, or lin-1 mutants, 64 of 70, 33 of 38 and 48 of 52, respectively, had the proper orientation with vulF facing the normal position of the AC (Table 7). In lin-17 mutants, six of seven also had the proper orientation (P>0.5, Table 7). Therefore, the intrinsic bias of the inner and outer cells to adopt a proper orientation in the 1° pattern is relatively normal when lin-17 is mutated." | Paper_evidence | WBPaper00004481 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007809 | PATO:0000460 | Paper_evidence | WBPaper00004481 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | syIs49 [zmp-1::GFP] | Paper_evidence | WBPaper00004481 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000594 | Paper_evidence | WBPaper00004662 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We therefore determined the orientation of P(11/12)L/R migration in mutants affecting P12 determination: a lin-44; lin-3 double mutant, a lin-17 mutant (LIN-17 is the putative receptor of Wnt/LIN-44; Herman et_al, 1995; Sawa et_al, 1996), a bar-1 mutant (BAR-1/Armadillo is an effector of the Wnt pathway; Eisenmann et_al, 1998), and an egl-5 mutant. In all mutants observed, both cells of the P11/12 pair generally adopt the P11 fate (Table 1A). If the migration handedness was a consequence of fate determination, it should be unbiased in these mutants. However, we see a biased migration pattern of P(11/12)L/R similar to that of wild type (Table 1A). Thus, a left-right asymmetry between the two cells of the P11/12 pair still exists in mutants of their final fate determination." | Paper_evidence | WBPaper00004662 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004409 | PATO:0000460 | Paper_evidence | WBPaper00004662 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000852 | Paper_evidence | WBPaper00002582 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 21 out of 25 adults produce coelomocytes. | Paper_evidence | WBPaper00002582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00002582 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00002582 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00002582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00004481 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We suspected that LIN-17 could be involved in the asymmetric divisions of the 1° VPC daughter P6.px, despite that the 1° lineage patterning is wild-type in lin-17(lf) mutants (Table 6). First, a lin-17::lacZ reporter gene was expressed in all P6.pxx cells (Sawa et al., 1996). Second, and more importantly, double mutants of lin-17 and lin-18, another gene involved in asymmetric divisions in the 2° vulval lineage, show defects in zmp-1::GFP expression in P6.pxxx cells, although neither single mutant does (Table 6; Ferguson et al., 1987; M. W., W. Katz and P. W. S., unpublished)." | Paper_evidence | WBPaper00004481 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007809 | PATO:0000460 | Paper_evidence | WBPaper00004481 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | syIs49 [zmp-1::GFP] | Paper_evidence | WBPaper00004481 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001224 | Paper_evidence | WBPaper00060654 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | There are six Wnt receptors encoded in the C. elegans genome: four Frizzled receptors (LIN-17, CFZ-2, MIG-1 and MOM-5,), one Ror receptor (CAM-1) and one Ryk receptor (LIN-18) (Sawa and Korswagen, 2013). We analyzed the effect of loss-of-function mutations for each receptor and found that loss of cam-1, but not the other receptors, caused defective SMDD axonal development (Figure 1D). | Paper_evidence | WBPaper00060654 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004972 | PATO:0000460 | Paper_evidence | WBPaper00060654 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0004971 | PATO:0000460 | Paper_evidence | WBPaper00060654 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001235 | Paper_evidence | WBPaper00004436 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Animals exhibited wild type V5 cell division polarity (Table 2) | Paper_evidence | WBPaper00004436 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004890 | PATO:0000460 | Paper_evidence | WBPaper00004436 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004876 | PATO:0000460 | Paper_evidence | WBPaper00004436 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004250 | PATO:0000460 | Paper_evidence | WBPaper00004436 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0007446 | PATO:0000460 | Paper_evidence | WBPaper00004436 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004246 | PATO:0000460 | Paper_evidence | WBPaper00004436 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0007463 | PATO:0000460 | Paper_evidence | WBPaper00004436 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00004436 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00004436 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference (36) | |||||||||
Method | Substitution_allele |