WormBase Tree Display for Variation: WBVar00089624
expand all nodes | collapse all nodes | view schema
WBVar00089624 | Name | Public_name | n611 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | CE09156:p.Trp357Ter | ||||||||
F01D4.4.1:c.1071G>A | |||||||||
HGVSg | CHROMOSOME_IV:g.10479060C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | F01D4 | |||||
Flanking_sequences | caaccagaaatccattttcgagtatgtttg | aaatctcacagcggagttaagggaatggtt | |||||||
Mapping_target | F01D4 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00030763 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00026827 | ||||||||
WBStrain00026874 | |||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001189 | |||||||
Transcript | F01D4.4.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F01D4.4.1:c.1071G>A | ||||||||
HGVSp | CE09156:p.Trp357Ter | ||||||||
cDNA_position | 1148 | ||||||||
CDS_position | 1071 | ||||||||
Protein_position | 357 | ||||||||
Exon_number | 5/7 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
Genetics | Interpolated_map_position | IV | 4.60112 | ||||||
Mapping_data | In_multi_point | 626 | |||||||
Description | Phenotype (24) | ||||||||
Phenotype_not_observed | WBPhenotype:0001780 | Paper_evidence | WBPaper00029060 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants show normal butanone enhancement | Paper_evidence | WBPaper00029060 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00029060 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Preexposure to 1:10 dilution of butanone and food. Animals were then subjected to odorant chemotaxis assays and/or selection assays | Paper_evidence | WBPaper00029060 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00043908 | ||||||||
WBPaper00000635 | |||||||||
WBPaper00029060 | |||||||||
Method | Substitution_allele |