WormBase Tree Display for Variation: WBVar00089524
expand all nodes | collapse all nodes | view schema
WBVar00089524 | Evidence | Paper_evidence | WBPaper00005774 | ||
---|---|---|---|---|---|
Name | Public_name | n477 | |||
Sequence_details | SMap | S_parent | Sequence | F55A8 | |
Flanking_sequences | gtcgacgacttccgagaggagtttgcacag | ctgaaaaatgtgaagaggctagcgacactt | |||
Mapping_target | F55A8 | ||||
Type_of_mutation | Insertion | ||||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00026778 | ||||
Laboratory | MT | ||||
Status | Live | ||||
Affects | Gene | WBGene00001173 | |||
Transcript (9) | |||||
Interactor | WBInteraction000500289 | ||||
Genetics | Interpolated_map_position | IV | -14.2686 | ||
Description | Phenotype (20) | ||||
Phenotype_not_observed (9) | |||||
Reference | WBPaper00004310 | ||||
WBPaper00010745 | |||||
WBPaper00000635 | |||||
WBPaper00017625 | |||||
WBPaper00010687 | |||||
WBPaper00011220 | |||||
WBPaper00023070 | |||||
WBPaper00035944 | |||||
WBPaper00018461 | |||||
WBPaper00061691 | |||||
Remark | Flanking sequences are based on 30 bp to the left and right of V464 and T465 | Curator_confirmed | WBPerson1845 | ||
n477 has an eight-base pair insertion between V464 and T465, which causes a frameshift and a stop codon and leads to loss of the kinase domain | Paper_evidence | WBPaper00005774 | |||
Method | Insertion_allele |