WormBase Tree Display for Variation: WBVar00089478
expand all nodes | collapse all nodes | view schema
WBVar00089478 | Evidence | Person_evidence | WBPerson27644 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n389 | |||||||
Sequence_details | SMap | S_parent | Sequence | ZC247 | |||||
Flanking_sequences | cactgtgctcggaaaatgctggcatcagtc | ttgaacatttctaattctaaatattatagt | |||||||
Mapping_target | ZC247 | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00026745 | ||||||||
WBStrain00027230 | |||||||||
WBStrain00027231 | |||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects (3) | |||||||||
Genetics | Interpolated_map_position | I | 4.79669 | ||||||
Mapping_data | In_2_point | 3202 | |||||||
In_multi_point | 402 | ||||||||
403 | |||||||||
In_pos_neg_data | 748 | ||||||||
756 | |||||||||
765 | |||||||||
Description | Phenotype (16) | ||||||||
Phenotype_not_observed | WBPhenotype:0000717 | Paper_evidence | WBPaper00004906 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | lin-11 mutants do not exhibit gene expression defects in ASH, ADL, ADF, ASER, ASEL, AWB, ASI, AFD and AVA | Paper_evidence | WBPaper00004906 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00004906 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | ntIs1 (gcy-5::GFP), oyIs17 (gcy-8::GFP), kyIs128 (str-3::GFP), kyIs104 (str-1::GFP), oyIs14 (sra-6::GFP), otIs24 (sre-1::GFP), oyIs34 (T08G3.3::GFP), kyIs5 (ceh-23::GFP), kyIs29 (glr-1::GFP), lim-6p::GFP and gmIs12 (srb-6::GFP) | Paper_evidence | WBPaper00004906 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No disruption of ASE asymmetry (as seen with gcy-7 reporters) | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | otIs3 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants respond normally to CO2 | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00004906 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | lin-11 mutants do not exhibit defects in DiI filling | Paper_evidence | WBPaper00004906 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00004906 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | DiI filling | Paper_evidence | WBPaper00004906 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference (11) | |||||||||
Remark (2) | |||||||||
Method | Deletion_allele |