WormBase Tree Display for Variation: WBVar00089401
expand all nodes | collapse all nodes | view schema
WBVar00089401 | Evidence | Paper_evidence | WBPaper00004442 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n301 | |||||||
Other_name | K10G6.1.1:c.185G>A | ||||||||
CE12098:p.Arg62Gln | |||||||||
HGVSg | CHROMOSOME_II:g.3983472G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | K10G6 | |||||
Flanking_sequences | gtaatgttttcaggtggcaaaactccctgc | acacaacttgtcattcaacgactgcttcat | |||||||
Mapping_target | K10G6 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (15) | |||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects (3) | |||||||||
Isolation | Mutagen | EMS | |||||||
Genetics | Interpolated_map_position | II | -5.88214 | ||||||
Mapping_data | In_2_point | 783 | |||||||
784 | |||||||||
In_multi_point (14) | |||||||||
In_pos_neg_data (13) | |||||||||
Description | Phenotype (10) | ||||||||
Phenotype_not_observed | WBPhenotype:0000054 | Paper_evidence | WBPaper00005344 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00005344 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000099 | Paper_evidence | WBPaper00005344 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | The lin-31(n301) mutation did not result in any animals with the '0 P11.p' phenotype (P11 adopts a P12 fate) or the '2 P11.p' phenotype (P12 adopts a P11 fate) | Paper_evidence | WBPaper00005344 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00005344 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000170 | Paper_evidence | WBPaper00026707 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000640 | Paper_evidence | WBPaper00026707 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Low | <1% (n=337) | Paper_evidence | WBPaper00026707 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00026863 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 0% animals produced progeny (n=33). | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | All strains were grown at 20C. | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00038408 | |||||||
WBPaper00004481 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | arIs131[lag-2p::2Xnls::yfp] is expressed specifically in P6.p in a lin-31(0) null mutant, as in wild type; arIs131[lag-2p::2nls-yfp::unc-54 3'UTR] expression remains P6.p specific. | Paper_evidence | WBPaper00038408 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
"In a lin-31 mutant background, VPCs adopt vulval or non-vulval fates randomly, although P6.p is always the closest VPC to the AC. We scored the patterning of P6.p descendants only when P6.p adopted the 1° fate (scored according to detachment of the descendants from ventral cuticle and symmetry of invagination; Katz et al., 1995), and found that it displayed the wild-type zmp-1::GFP expression pattern in its progeny in all cases (n=31 animals, Table 5). Therefore, lin-31 is likely not required during 1° lineage patterning." | Paper_evidence | WBPaper00004481 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007809 | PATO:0000460 | Paper_evidence | WBPaper00004481 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | syIs49 [zmp-1::GFP] | Paper_evidence | WBPaper00004481 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001024 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Male gross morphology wildtype. Similar phenotype in n301/Df. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (13) | |||||||||
Method | Substitution_allele |