WormBase Tree Display for Variation: WBVar00089103
expand all nodes | collapse all nodes | view schema
WBVar00089103 | Evidence | Person_evidence | WBPerson625 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name (3) | |||||||||
Sequence_details | SMap | S_parent | Sequence | ZK1067 | |||||
Flanking_sequences | caatgcgatgacttggaagaactgagcttaaactcattgaaacttataaaaact | gagctgtattaataatgaaaaatcatcgattgtgttatgtgtcgaaaattgattggtcatca | |||||||
Mapping_target | ZK1067 | ||||||||
Type_of_mutation | Substitution | g | a | Person_evidence | WBPerson625 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin (4) | |||||||||
Affects | Gene | WBGene00002299 | |||||||
Transcript | ZK1067.1d.1 (12) | ||||||||
ZK1067.1b.1 (12) | |||||||||
ZK1067.1c.1 (12) | |||||||||
ZK1067.1a.1 (12) | |||||||||
Isolation | Mutagen | EMS | |||||||
Forward_genetics | balanced lethal | ||||||||
Genetics | Interpolated_map_position | II | 1.09443 | ||||||
Description | Phenotype | WBPhenotype:0000411 | Paper_evidence | WBPaper00000762 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00000762 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000023 | PATO:0000460 | Paper_evidence | WBPaper00000762 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000698 | Paper_evidence | WBPaper00000762 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Only observed in a let-23 heteroallelic strain: mn216/n1045 | Paper_evidence | WBPaper00000762 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00000762 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00000762 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | mn216/n1045 | Paper_evidence | WBPaper00000762 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00014296 | ||||||||
WBPaper00000762 | |||||||||
WBPaper00014627 | |||||||||
WBPaper00013924 | |||||||||
WBPaper00001917 | |||||||||
Remark | isolated by RK Herman; sequenced by Sternberg lab. | ||||||||
alt_det = G469R. gga to aga codon mut_det = g to a | |||||||||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00002299 Missense 469 G to R | |||||||||
Method | Substitution_allele |