WormBase Tree Display for Variation: WBVar00088999
expand all nodes | collapse all nodes | view schema
WBVar00088999 | Evidence | Person_evidence | WBPerson10095 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | mn4 | |||||
Other_name | Y73B6BL.34.1:c.211C>A | ||||||
CE29928:p.Arg71Ser | |||||||
HGVSg | CHROMOSOME_IV:g.6377425C>A | ||||||
Sequence_details | SMap | S_parent | Sequence | Y73B6BL | |||
Flanking_sequences | ctcaacgaggtctcctcgatccgttccaac | gtaccgcccgtcaagcttcttacggagatt | |||||
Mapping_target | Y73B6BL | ||||||
Type_of_mutation | Substitution | c | a | ||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00034209 | ||||||
Laboratory | SP | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00000256 | |||||
Transcript | Y73B6BL.34.1 (12) | ||||||
Genetics (2) | |||||||
Description | Phenotype | WBPhenotype:0000025 | Person_evidence | WBPerson261 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | mn4/+ always blistered | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Dominant | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00014270 | ||||||
WBPaper00016554 | |||||||
WBPaper00013734 | |||||||
WBPaper00014080 | |||||||
Remark | alt_det = c to a mut_det = R71S | Person_evidence | WBPerson10095 | ||||
Curator_confirmed | WBPerson51134 | ||||||
Variation information submitted by WBPerson10095 on 2022-02-17_15:51:37 via the Allele submission form. | Curator_confirmed | WBPerson51134 | |||||
Method | Substitution_allele |