WormBase Tree Display for Variation: WBVar00088949
expand all nodes | collapse all nodes | view schema
WBVar00088949 | Evidence | Person_evidence | WBPerson315 | ||||||
---|---|---|---|---|---|---|---|---|---|
WBPerson3294 | |||||||||
Name | Public_name | mg366 | |||||||
Other_name | CE30163:p.Asn268LysfsTer46 | ||||||||
CE17214:p.Asn268LysfsTer46 | |||||||||
T07A9.5d.1:c.185_186insAAAAAAACAGGCACTTTATCGAA | |||||||||
CE48636:p.Asn62LysfsTer46 | |||||||||
T07A9.5c.1:c.185_186insAAAAAAACAGGCACTTTATCGAA | |||||||||
T07A9.5b.1:c.803_804insAAAAAAACAGGCACTTTATCGAA | |||||||||
CE49054:p.Asn62LysfsTer46 | |||||||||
T07A9.5a.1:c.803_804insAAAAAAACAGGCACTTTATCGAA | |||||||||
HGVSg | CHROMOSOME_IV:g.418238_418239insTTCGATAAAGTGCCTGTTTTTTT | ||||||||
Sequence_details | SMap | S_parent | Sequence | T07A9 | |||||
Flanking_sequences | ataaaacttcggaacatatggggcattcgaata | ttcgataaaaggcattgaaattgcatgaatt | |||||||
Mapping_target | T07A9 | ||||||||
Type_of_mutation | Insertion | ttcgataaagtgcctgttttttt | Person_evidence | WBPerson3294 | |||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (18) | |||||||||
Laboratory | GR | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001332 | |||||||
Transcript | T07A9.5b.1 | VEP_consequence | frameshift_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | T07A9.5b.1:c.803_804insAAAAAAACAGGCACTTTATCGAA | ||||||||
HGVSp | CE30163:p.Asn268LysfsTer46 | ||||||||
cDNA_position | 810-811 | ||||||||
CDS_position | 803-804 | ||||||||
Protein_position | 268 | ||||||||
Exon_number | 7/14 | ||||||||
Codon_change | aat/aaAAAAAAACAGGCACTTTATCGAAt | ||||||||
Amino_acid_change | N/KKKQALYRX | ||||||||
T07A9.5d.1 | VEP_consequence | frameshift_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | T07A9.5d.1:c.185_186insAAAAAAACAGGCACTTTATCGAA | ||||||||
HGVSp | CE48636:p.Asn62LysfsTer46 | ||||||||
cDNA_position | 185-186 | ||||||||
CDS_position | 185-186 | ||||||||
Protein_position | 62 | ||||||||
Exon_number | 3/9 | ||||||||
Codon_change | aat/aaAAAAAAACAGGCACTTTATCGAAt | ||||||||
Amino_acid_change | N/KKKQALYRX | ||||||||
T07A9.5c.1 | VEP_consequence | frameshift_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | T07A9.5c.1:c.185_186insAAAAAAACAGGCACTTTATCGAA | ||||||||
HGVSp | CE49054:p.Asn62LysfsTer46 | ||||||||
cDNA_position | 185-186 | ||||||||
CDS_position | 185-186 | ||||||||
Protein_position | 62 | ||||||||
Exon_number | 3/5 | ||||||||
Codon_change | aat/aaAAAAAAACAGGCACTTTATCGAAt | ||||||||
Amino_acid_change | N/KKKQALYRX | ||||||||
T07A9.5a.1 | VEP_consequence | frameshift_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | T07A9.5a.1:c.803_804insAAAAAAACAGGCACTTTATCGAA | ||||||||
HGVSp | CE17214:p.Asn268LysfsTer46 | ||||||||
cDNA_position | 810-811 | ||||||||
CDS_position | 803-804 | ||||||||
Protein_position | 268 | ||||||||
Exon_number | 7/10 | ||||||||
Codon_change | aat/aaAAAAAAACAGGCACTTTATCGAAt | ||||||||
Amino_acid_change | N/KKKQALYRX | ||||||||
Interactor (252) | |||||||||
Isolation | Mutagen | EMS | |||||||
Forward_genetics | screen for enhanced RNAi | ||||||||
Genetics | Interpolated_map_position | IV | -26.023 | ||||||
Description | Phenotype (15) | ||||||||
Phenotype_not_observed | WBPhenotype:0001759 | Paper_evidence | WBPaper00031962 | ||||||
WBPaper00035199 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Levels of 21U-RNA, from Nothern blot or from qRT-PRC, were comparable to that of wild-type. | Paper_evidence | WBPaper00031962 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Animals retain the ability to express this class of small regulatory RNAs. | Paper_evidence | WBPaper00035199 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | GO_term | GO:0034585 | PATO:0000460 | Paper_evidence | WBPaper00031962 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001778 | Paper_evidence | WBPaper00032049 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Of animals exposed to dsRNA targeting nuclear-localized lin-15b, 95 4% exhibited a Muv phenotype. In addition, a decrease in both lin-15b and lin-15a pre-mRNA abundance was observed. | Paper_evidence | WBPaper00032049 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were fed bacteria expressing dsRNAs. | Paper_evidence | WBPaper00032049 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001779 | Paper_evidence | WBPaper00035199 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals retain the ability to express this class of small regulatory RNAs. | Paper_evidence | WBPaper00035199 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (17) | |||||||||
Remark | |||||||||
Method | Insertion_allele |