WormBase Tree Display for Variation: WBVar00088942
expand all nodes | collapse all nodes | view schema
| WBVar00088942 | Evidence | Paper_evidence | WBPaper00027748 | ||||
|---|---|---|---|---|---|---|---|
| Person_evidence | WBPerson272 | ||||||
| Name | Public_name | mg342 | |||||
| Sequence_details | SMap | S_parent | Sequence | Y44A6D | |||
| Flanking_sequences | ccctaagactagatatattattttcaaaat | aaggaaatctccacagctgaagatatatac | |||||
| Mapping_target | Y44A6D | ||||||
| Type_of_mutation | Substitution | G | A | Paper_evidence | WBPaper00027748 | ||
| Person_evidence | WBPerson272 | ||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | GR | ||||||
| Status | Live | ||||||
| Possibly_affects | WBGene00004748 | ||||||
| Isolation | Mutagen | EMS | Paper_evidence | WBPaper00027748 | |||
| Person_evidence | WBPerson272 | ||||||
| Genetics | Interpolated_map_position | V | 25.2509 | ||||
| Reference | WBPaper00027748 | ||||||
| Remark | Further study of 5' region of sdf-9 may show that this mutation is a M(1) to I missense rather than a promoter region mutation. | Person_evidence | WBPerson71 | ||||
| WBPerson272 | |||||||
| Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00004748 Regulatory_feature | Paper_evidence | WBPaper00027748 | |||||
| Method | Substitution_allele |
