WormBase Tree Display for Variation: WBVar00088913
expand all nodes | collapse all nodes | view schema
WBVar00088913 | Name | Public_name | mg144 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | C12D8.10c.1:c.547G>A | ||||||||
C12D8.10a.1:c.547G>A | |||||||||
C12D8.10b.1:c.547G>A | |||||||||
CE31304:p.Ala183Thr | |||||||||
CE05274:p.Ala183Thr | |||||||||
CE15612:p.Ala183Thr | |||||||||
HGVSg | CHROMOSOME_V:g.10250416G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | C12D8 | |||||
Flanking_sequences | ATGATTAGTATTGCTGACACCAGCGAAGCT | CTAAAAGAGACAAAATCGTAAGAAAACCTA | |||||||
Mapping_target | C12D8 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00007898 | ||||||||
Laboratory | GR | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000102 | |||||||
Transcript | C12D8.10c.1 (12) | ||||||||
C12D8.10b.1 (12) | |||||||||
C12D8.10a.1 (12) | |||||||||
Interactor (12) | |||||||||
Genetics | Interpolated_map_position | V | 2.42337 | ||||||
Description | Phenotype | WBPhenotype:0000315 | Paper_evidence | WBPaper00046423 | |||||
Curator_confirmed | WBPerson10425 | ||||||||
Remark | reduced sensitivity to gentle touch on the anterior half of the body. | Paper_evidence | WBPaper00046423 | ||||||
Curator_confirmed | WBPerson10425 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00046423 | ||||||
Curator_confirmed | WBPerson10425 | ||||||||
Recessive | Paper_evidence | WBPaper00046423 | |||||||
Curator_confirmed | WBPerson10425 | ||||||||
WBPhenotype:0000481 | Paper_evidence | WBPaper00037970 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | akt-1(mg144) mutant animals display a reduced aversion response to copper, compared to wild type animals (Figure 2B) | Paper_evidence | WBPaper00037970 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00002862 | Paper_evidence | WBPaper00037970 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000737 | Paper_evidence | WBPaper00029085 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | akt-1 gain-of-function mutants exhibited reduced sensitivity to DNA-damage-induced germ-cell apoptosis 12, 24, and 36 hr after irradiation | Paper_evidence | WBPaper00029085 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00029085 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations (2) | |||||||||
Phenotype_assay | Treatment | Treated with 60 Gy of IR | Paper_evidence | WBPaper00029085 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001351 | Paper_evidence | WBPaper00029085 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The levels of phosphorylated CEP-1 were lower in akt-1(mg144) than in wild-type worms at all doses of IR tested | Paper_evidence | WBPaper00029085 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00029085 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00029085 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | IR treatment | Paper_evidence | WBPaper00029085 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00029116 | |||||||
Curator_confirmed | WBPerson1754 | ||||||||
Remark | Blocks protein degradation in response to treatment with the AGE-1 inhibitor LY-294002 | Paper_evidence | WBPaper00029116 | ||||||
Curator_confirmed | WBPerson1754 | ||||||||
Affected_by | Molecule | WBMol:00005384 | Paper_evidence | WBPaper00029116 | |||||
Curator_confirmed | WBPerson1754 | ||||||||
WBPhenotype:0001788 | Paper_evidence | WBPaper00029085 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | akt-1 gain-of-function mutants showed a significant decrease in the number of germ-cell corpses after ENU treatment | Paper_evidence | WBPaper00029085 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00029085 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations (2) | |||||||||
Phenotype_assay | Treatment | Treated with 5mM ENU | Paper_evidence | WBPaper00029085 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001806 | Paper_evidence | WBPaper00029085 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | In akt-1 gain-of-function mutants, the stability of CEP-1 is reduced | Paper_evidence | WBPaper00029085 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00029085 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00029085 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | IR treatment | Paper_evidence | WBPaper00029085 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001999 | Paper_evidence | WBPaper00037970 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | The integration of signals for attraction to diacetyl (100x dilute) and avoidance from copper (100 millimolar) was impaired in akt-1(mg144) insulin-like signaling pathway mutants, resulting in more animals crossing the copper barrier to get to the diacetyl spot than in wild type controls (Figure 1C) | Paper_evidence | WBPaper00037970 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00002862 | Paper_evidence | WBPaper00037970 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBMol:00002819 | Paper_evidence | WBPaper00037970 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002256 | Paper_evidence | WBPaper00044686 | |||||||
Curator_confirmed | WBPerson1754 | ||||||||
Remark | Increased sensitivity to selenium induced movement decline | Paper_evidence | WBPaper00044686 | ||||||
Curator_confirmed | WBPerson1754 | ||||||||
Affected_by | Molecule | WBMol:00001915 | Paper_evidence | WBPaper00044686 | |||||
Curator_confirmed | WBPerson1754 | ||||||||
Phenotype_not_observed | WBPhenotype:0000145 | Paper_evidence | WBPaper00003173 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | mg144 has normal brood sizes. | Paper_evidence | WBPaper00003173 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000147 | Paper_evidence | WBPaper00040181 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The starvation induced ribosome biogenesis was not ablated in the starved male worms. Starvation-enhanced rRNA biosynthesisoccurs in adult males. | Paper_evidence | WBPaper00040181 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00040181 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000308 | Paper_evidence | WBPaper00003173 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | On its own mg144 does not have any obvious phenotype. The strain arrests as dauers on starved plates and on plates treated with pheromone. | Paper_evidence | WBPaper00003173 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00028886 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Localization of the synaptic protein SNB-1 is normal, based on transgene analysis with a reporter. | Paper_evidence | WBPaper00028886 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00028886 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000699 | Paper_evidence | WBPaper00003173 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | mg144 has a normal vulva. | Paper_evidence | WBPaper00003173 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000730 | Paper_evidence | WBPaper00029085 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | None of the akt mutants affected developmental apoptosis | Paper_evidence | WBPaper00029085 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00029085 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000741 | Paper_evidence | WBPaper00029085 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Germline cell-cycle arrest was not altered in either akt-1 gain-of-function or loss-of-function mutants | Paper_evidence | WBPaper00029085 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00029085 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000885 | Paper_evidence | WBPaper00029085 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | None of the akt mutants affected the engulfment rates of the germ-cell corpses | Paper_evidence | WBPaper00029085 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00029085 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001470 | Paper_evidence | WBPaper00037970 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Mutants exhibited no change in chemotaxis towards diacetyl, compared to wild type controls (Figure 2A) | Paper_evidence | WBPaper00037970 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00002819 | Paper_evidence | WBPaper00037970 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0004023 | Paper_evidence | WBPaper00037970 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Mutant animals exhibit a wild type frequency of body bends (Figure 3A) | Paper_evidence | WBPaper00037970 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00037970 | ||||||||
WBPaper00040181 | |||||||||
WBPaper00028886 | |||||||||
WBPaper00029085 | |||||||||
WBPaper00003173 | |||||||||
WBPaper00029116 | |||||||||
WBPaper00018509 | |||||||||
WBPaper00015792 | |||||||||
WBPaper00044686 | |||||||||
WBPaper00046423 | |||||||||
Method | Substitution_allele |