WormBase Tree Display for Variation: WBVar00088848
expand all nodes | collapse all nodes | view schema
WBVar00088848 | Evidence | Paper_evidence | WBPaper00003560 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | md1401 | ||||||
Other_name | CE24927:p.Ile133Val | |||||||
F27D9.1a.1:c.397A>G | ||||||||
HGVSg | CHROMOSOME_X:g.7683493A>G | |||||||
Sequence_details | SMap | S_parent | Sequence | F27D9 | ||||
Flanking_sequences | cgtttcatcaaaactctgaaggagattaac | tagctttcactccatacgaaagccaggtga | ||||||
Mapping_target | F27D9 | |||||||
Type_of_mutation | Substitution | a | g | Paper_evidence | WBPaper00003560 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | RM | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006757 | ||||||
Transcript | F27D9.1a.1 (12) | |||||||
Genetics | Interpolated_map_position | X | -1.35816 | |||||
Description | Phenotype | WBPhenotype:0000273 | Paper_evidence | WBPaper00032271 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | md1401 mutants moved slightly slower (30%) than the wild-type in solution | Paper_evidence | WBPaper00032271 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Genotype | unc-18(e81) | Paper_evidence | WBPaper00032271 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001613 | Paper_evidence | WBPaper00032271 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | The effects of ethanol to depress behavioral activity was reduced for md1401 worms in comparison with Bristol N2 wild types | Paper_evidence | WBPaper00032271 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | 400mM EtOH | Paper_evidence | WBPaper00032271 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Genotype | unc-18(e81) | Paper_evidence | WBPaper00032271 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Disease_info | Models_disease | DOID:1574 | ||||||
Models_disease_in_annotation | WBDOannot00000712 | |||||||
Reference | WBPaper00032271 | |||||||
Method | Substitution_allele |