WormBase Tree Display for Variation: WBVar00088803
expand all nodes | collapse all nodes | view schema
WBVar00088803 | Evidence | Paper_evidence | WBPaper00029143 | ||||
---|---|---|---|---|---|---|---|
Name (3) | |||||||
Sequence_details | SMap | S_parent | Sequence | F31E8 | |||
Flanking_sequences | tcattcaacttcgagacgatttttgaatat | aaggtgtctattgggatgtaatggaaccgg | |||||
Mapping_target | F31E8 | ||||||
Type_of_mutation | Deletion | ||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | RM | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00004921 | |||||
Transcript (2) | |||||||
Genetics | Interpolated_map_position | II | 0.115811 | ||||
Mapping_data | In_2_point | 6025 | |||||
In_multi_point | 2072 | ||||||
2073 | |||||||
In_pos_neg_data (11) | |||||||
Description | Phenotype | WBPhenotype:0000031 | Person_evidence | WBPerson261 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | slow-growing | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000229 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000563 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | slight shrinker | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000634 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | some pumping defects | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000643 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | uncoordinated | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000650 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | some defecation defects | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001289 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | resistant to cholinesterase inhibitors | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00029143 | ||||||
Remark | In addition to the deletion described md125 also deletes exons 1-3 | Paper_evidence | WBPaper00029143 | ||||
Method | Deletion_allele |