WormBase Tree Display for Variation: WBVar00088704
expand all nodes | collapse all nodes | view schema
WBVar00088704 | Evidence | Paper_evidence | WBPaper00005086 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | m540 | |||||||
Sequence_details | SMap | S_parent | Sequence | T13C5 | |||||
Flanking_sequences | aagtttaaaattctaaaatattaaaatttc | agatgaacataagccaaagttcttggataa | |||||||
Mapping_target | T13C5 | ||||||||
Type_of_mutation | Insertion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Transposon_insertion | |||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00006404 | ||||||||
Laboratory | DR | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000905 | |||||||
Transcript | T13C5.1b.1 | ||||||||
T13C5.1a.1 | |||||||||
Interactor | WBInteraction000500281 | ||||||||
WBInteraction000521459 | |||||||||
WBInteraction000521462 | |||||||||
WBInteraction000521465 | |||||||||
Genetics | Interpolated_map_position | X | -3.47349 | ||||||
Description | Phenotype | WBPhenotype:0000308 | Paper_evidence | WBPaper00005086 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals resume development to fertile adults after 1-2 days. Recovery from Dauer and post recovery mophology is affected by cholesterol levels. Decreased cholesterol shifts the mutant phenotypes towards the stronger alleles; e.g. 20% recovery from Dauer, recovered adults are sick and sterile. | Paper_evidence | WBPaper00005086 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000447 | Paper_evidence | WBPaper00040979 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Most daf-9(dh6) null animals developed into abnormal adults when supplemented with a minimum of 10 nM DA (Figure 2B, 74% +/- 42% non-dauers), suggesting that a threshold of DA has to be crossed before committing to adult fate (dauer bypass DA threshold). Increasing the levels to 25 nM DA decreased the frequency of dauers to 99% +/- 1% with about 66% of animals developing normally (Figure 2B). Further increase of DA to 50 nM increased the frequency of normal adults (Figure 2B). For a distribution of Mig and Cut phenotypes, see Figure S2. Similar results were observed with animals homozygous for daf- 9(e1406) or daf-9(m540) (Figure S2; worms were not synchronously hatched), both of which are strong loss-of-function alleles." | Paper_evidence | WBPaper00040979 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001739 | Paper_evidence | WBPaper00045724 | |||||||
Curator_confirmed | WBPerson4671 | ||||||||
Remark | unable to respond to dietary restriction | Paper_evidence | WBPaper00045724 | ||||||
Curator_confirmed | WBPerson4671 | ||||||||
WBPhenotype:0001983 | Paper_evidence | WBPaper00032266 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males homozygous for the hypomorphic allele daf-9(m540) had a slow rate of leaving like the daf-12 loss-of-function phenotype. Growth on DA-supplemented medium restored the leaving rate of adult males to the wild-type level. | Paper_evidence | WBPaper00032266 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00032266 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000012 | Paper_evidence | WBPaper00005086 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000061 | Paper_evidence | WBPaper00005086 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00005086 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 15C, 20C, 25C | Paper_evidence | WBPaper00005086 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001653 | Paper_evidence | WBPaper00026674 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 3 | Paper_evidence | WBPaper00026674 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00003022 | Paper_evidence | WBPaper00026674 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00040979 | ||||||||
WBPaper00032266 | |||||||||
WBPaper00005086 | |||||||||
WBPaper00026674 | |||||||||
WBPaper00045724 | |||||||||
Method | Transposon_insertion |