WormBase Tree Display for Variation: WBVar00088665
expand all nodes | collapse all nodes | view schema
| WBVar00088665 | Evidence | Paper_evidence | WBPaper00001271 | |||||
|---|---|---|---|---|---|---|---|---|
| Name | Public_name | m402 | ||||||
| Sequence_details | SMap | S_parent | Sequence | F29C4 | ||||
| Flanking_sequences | tgctcgagaatacggttaacattgagacgt | attataatttgatgaggtcgacggcaagtg | ||||||
| Mapping_target | F29C4 | |||||||
| Type_of_mutation | Insertion | |||||||
| SeqStatus | Sequenced | |||||||
| Variation_type | Allele | |||||||
| Transposon_insertion | Tc1 | |||||||
| Origin | Species | Caenorhabditis elegans | ||||||
| Strain | WBStrain00006343 | |||||||
| WBStrain00030754 | ||||||||
| Laboratory | DR | |||||||
| Status | Live | |||||||
| Affects | Gene | WBGene00000897 | ||||||
| Transcript | F29C4.1b.1 | |||||||
| F29C4.1a.1 | ||||||||
| Genetics | Interpolated_map_position | IV | -26.9026 | |||||
| Description | Phenotype | WBPhenotype:0000012 | Paper_evidence | WBPaper00001271 | ||||
| Curator_confirmed | WBPerson557 | |||||||
| Remark | Temperature sensitive allele. At 22.5C it is Daf-c, but only partially at 15C. | Paper_evidence | WBPaper00001271 | |||||
| Curator_confirmed | WBPerson557 | |||||||
| Laboratory_evidence | DR | |||||||
| Recessive | Paper_evidence | WBPaper00001271 | ||||||
| Curator_confirmed | WBPerson557 | |||||||
| Temperature_sensitive | Heat_sensitive | 15 | Paper_evidence | WBPaper00001271 | ||||
| Curator_confirmed | WBPerson557 | |||||||
| Maternal | ||||||||
| Phenotype_assay | Temperature | 22.5 | Paper_evidence | WBPaper00001271 | ||||
| Curator_confirmed | WBPerson557 | |||||||
| Phenotype_not_observed | WBPhenotype:0000845 | Paper_evidence | WBPaper00034730 | |||||
| Curator_confirmed | WBPerson2021 | |||||||
| Remark | Mutants had normal sensitivity to cholinergic agonists | Paper_evidence | WBPaper00034730 | |||||
| Curator_confirmed | WBPerson2021 | |||||||
| Affected_by | Molecule | WBMol:00004019 | Paper_evidence | WBPaper00034730 | ||||
| Curator_confirmed | WBPerson2021 | |||||||
| WBPhenotype:0001573 | Paper_evidence | WBPaper00034730 | ||||||
| Curator_confirmed | WBPerson2021 | |||||||
| Remark | Mutants had normal sensitivity to cholinergic agonists | Paper_evidence | WBPaper00034730 | |||||
| Curator_confirmed | WBPerson2021 | |||||||
| Reference | WBPaper00001271 | |||||||
| WBPaper00034730 | ||||||||
| WBPaper00015561 | ||||||||
| Method | Transposon_insertion |
