WormBase Tree Display for Variation: WBVar00088579
expand all nodes | collapse all nodes | view schema
| WBVar00088579 | Evidence | Paper_evidence | WBPaper00004181 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | m116 | |||||||
| Other_name (15) | |||||||||
| HGVSg | CHROMOSOME_X:g.10661533G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | F11A1 | |||||
| Flanking_sequences | tcacatgcgaatcttgtaaagcattcttca | gagaaatgcgttacgtcccaaggtaacttt | |||||||
| Mapping_target | F11A1 | ||||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00004181 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00006257 | ||||||||
| Laboratory | DR | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00000908 | |||||||
| Transcript | F11A1.3b.1 (12) | ||||||||
| F11A1.3e.2 (12) | |||||||||
| F11A1.3e.1 (12) | |||||||||
| F11A1.3e.4 (12) | |||||||||
| F11A1.3f.1 (12) | |||||||||
| F11A1.3a.1 (12) | |||||||||
| F11A1.3g.1 (12) | |||||||||
| F11A1.3e.3 (12) | |||||||||
| F11A1.3d.1 (12) | |||||||||
| Interactor (5) | |||||||||
| Genetics | Interpolated_map_position | X | 2.36892 | ||||||
| Description | Phenotype | WBPhenotype:0000013 | Paper_evidence | WBPaper00002149 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000154 | Paper_evidence | WBPaper00002149 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Temperature | 15C, 25C | Paper_evidence | WBPaper00002149 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001171 | Paper_evidence | WBPaper00002149 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Mean life span slightly shorter than N2 under same conditions. In control experiments, the life spans were nearly like that of wild type at 15. | Paper_evidence | WBPaper00002149 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00002149 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00002149 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Treatment | Animals were raised at 15C and placed at 25.5C as L4 larvae or young adults for the life span assay. | Paper_evidence | WBPaper00002149 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Temperature | 25.5C | Paper_evidence | WBPaper00002149 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_not_observed | WBPhenotype:0001690 | Paper_evidence | WBPaper00002589 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Animals were positive for mAb M37 at the L1 stage but not at any other stage, similar to N2 animals. | Paper_evidence | WBPaper00002589 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Penetrance | Low | Paper_evidence | WBPaper00002589 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Temperature | 27.5 | Paper_evidence | WBPaper00002589 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001692 | Paper_evidence | WBPaper00002589 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Animals were induced by pheromone to display the L2 M37 epitope to the same extent as wildtype e.g. animals exhibit ILD. | Paper_evidence | WBPaper00002589 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Reference | WBPaper00002589 | ||||||||
| WBPaper00002149 | |||||||||
| Method | Substitution_allele |
