WormBase Tree Display for Variation: WBVar00088578
expand all nodes | collapse all nodes | view schema
WBVar00088578 | Evidence | Paper_evidence | WBPaper00015544 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | m94 | |||||||
Other_name | CE01925:p.Glu781Lys | ||||||||
F30H5.1.1:c.2341G>A | |||||||||
HGVSg | CHROMOSOME_III:g.499436G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F30H5 | |||||
Flanking_sequences | tttgaaagagaaggcaattccaaagattgag | aattctggtttatgacggatcacgagcattt | |||||||
Mapping_target | F30H5 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003295 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00006179 | ||||||||
Laboratory | DR | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006781 | |||||||
Transcript | F30H5.1.1 (12) | ||||||||
Interactor | WBInteraction000050761 | ||||||||
WBInteraction000050762 | |||||||||
WBInteraction000534892 | |||||||||
WBInteraction000534894 | |||||||||
WBInteraction000534896 | |||||||||
Isolation | Mutagen | hydroxylamine | |||||||
Genetics | Interpolated_map_position | III | -26.8216 | ||||||
Description | Phenotype | WBPhenotype:0000119 | Paper_evidence | WBPaper00065280 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | We induced UNC-45 dysfunction by RNAi-mediated depletion of unc-45 or by the unc-45(m94) ts mutant and observed stabilization of the UbV-mCherry protein specifically in BWM (Figure 1C and 1E). Since myosin is the major muscle protein, impairment of its folding by UNC-45 may lead to UPS overload in muscle. | Paper_evidence | WBPaper00065280 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005813 | PATO:0000460 | Paper_evidence | WBPaper00065280 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000273 | Paper_evidence | WBPaper00065280 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | When grown at the permissive temperature of 15C, unc-45(m94) are superficially wild-type. | Paper_evidence | WBPaper00065280 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00065280 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000352 | Person_evidence | WBPerson2251 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00046852 | |||||||
Person_evidence | WBPerson2251 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson2987 | |||||||||
Remark | "A single amino acid substitute in the UCS domain of C-elegans UNC-45, E781K, or L822F (the m94 and e286 alleles, respectively), results in temperature-sensitive motility defects (Figure 1B) and myosin disorganization phenotypes (Figure 1C) when animals are grown at restrictive conditions (>22 degrees Celsius). However, animals show no phenotypes during development and early adulthood when grown at the permissive temperature (15 degrees Celsius C)." | Paper_evidence | WBPaper00046852 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001403 | Paper_evidence | WBPaper00046852 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Animals expressing unc-45(e286) or unc-45(m94) that were shifted to restrictive conditions after the first larval stage exhibited disruption of myofilament structure associated with mislocalization of MYO-3, while wild-type animals were unaffected (Figure 3B)." | Paper_evidence | WBPaper00046852 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00046852 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001569 | Paper_evidence | WBPaper00046852 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "A single amino acid substitute in the UCS domain of C-elegans UNC-45, E781K, or L822F (the m94 and e286 alleles, respectively), results in temperature-sensitive motility defects (Figure 1B) and myosin disorganization phenotypes (Figure 1C) when animals are grown at restrictive conditions (>22 degrees Celsius). However, animals show no phenotypes during development and early adulthood when grown at the permissive temperature (15 degrees Celsius C)." | Paper_evidence | WBPaper00046852 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001889 | Paper_evidence | WBPaper00046852 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Animals expressing unc-45(e286) or unc-45(m94) that were shifted to restrictive conditions after the first larval stage exhibited disruption of myofilament structure associated with mislocalization of MYO-3, while wild-type animals were unaffected (Figure 3B)." | Paper_evidence | WBPaper00046852 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00046852 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000518 | Paper_evidence | WBPaper00046852 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "A single amino acid substitute in the UCS domain of C-elegans UNC-45, E781K, or L822F (the m94 and e286 alleles, respectively), results in temperature-sensitive motility defects (Figure 1B) and myosin disorganization phenotypes (Figure 1C) when animals are grown at restrictive conditions (>22 degrees Celsius). However, animals show no phenotypes during development and early adulthood when grown at the permissive temperature (15 degrees Celsius C)." | Paper_evidence | WBPaper00046852 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Temperature | 15 | Paper_evidence | WBPaper00046852 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000644 | Paper_evidence | WBPaper00046852 | |||||||
Curator_confirmed | WBPerson5063 | ||||||||
Remark | At 15C animals are WT on control RNAi but are fully paralyzed on daf-21, C01G10.8, sti-1 or ZC395.10 RNAi. WT animals do not show paralysis when treated with these RNAi. Similar phenotype can be observed when m94 is crossed to ok3501. | Paper_evidence | WBPaper00046852 | ||||||
Curator_confirmed | WBPerson5063 | ||||||||
Phenotype_assay | Temperature | 15 | Paper_evidence | WBPaper00046852 | |||||
Curator_confirmed | WBPerson5063 | ||||||||
Reference | WBPaper00015544 | ||||||||
WBPaper00046852 | |||||||||
WBPaper00065280 | |||||||||
Method | Substitution_allele |