WormBase Tree Display for Variation: WBVar00088550
expand all nodes | collapse all nodes | view schema
WBVar00088550 | Evidence | Paper_evidence | WBPaper00005073 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | m41 | ||||||
Other_name | CE46852:p.Gly383Glu | |||||||
CE50204:p.Gly383Glu | ||||||||
Y55D5A.5a.1:c.1148G>A | ||||||||
Y55D5A.5d.1:c.1007G>A | ||||||||
Y55D5A.5c.1:c.1148G>A | ||||||||
CE50312:p.Gly336Glu | ||||||||
Y55D5A.5e.1:c.920G>A | ||||||||
CE50158:p.Gly307Glu | ||||||||
HGVSg | CHROMOSOME_III:g.3013413C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | Y55D5A | ||||
Flanking_sequences | atgatcgtcttcttccaacgaaagaaatcg | accgggatgtgatgcgaacggcgatcgatg | ||||||
Mapping_target | Y55D5A | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00005073 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00006376 | |||||||
WBStrain00030727 | ||||||||
WBStrain00030735 | ||||||||
WBStrain00030764 | ||||||||
Laboratory | DR | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00000898 | ||||||
Transcript | Y55D5A.5e.1 (12) | |||||||
Y55D5A.5a.1 (12) | ||||||||
Y55D5A.5c.1 (12) | ||||||||
Y55D5A.5d.1 (12) | ||||||||
Interactor (25) | ||||||||
Genetics | Interpolated_map_position | III | -8.0571 | |||||
Description | Phenotype (13) | |||||||
Phenotype_not_observed | WBPhenotype:0001690 | Paper_evidence | WBPaper00002589 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals bind mAb M37 at the L1 stage as observed for wild-type animals. Animals in dauer stage do not bind mAb 37, similar to wildtype. | Paper_evidence | WBPaper00002589 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00002589 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 16 | Paper_evidence | WBPaper00002589 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference (25) | ||||||||
Method | Substitution_allele |