WormBase Tree Display for Variation: WBVar00088537
expand all nodes | collapse all nodes | view schema
WBVar00088537 | Evidence | Paper_evidence | WBPaper00004181 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name (3) | |||||||||
Sequence_details | SMap | S_parent | Sequence | F11A1 | |||||
Flanking_sequences | tgatattatgaatattatggatgttaccat | aggcgtttcgtcaaagttgccaaaggtgtt | |||||||
Mapping_target | F11A1 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00004181 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00006155 | ||||||||
Laboratory | DR | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000908 | |||||||
Transcript | F11A1.3b.1 (12) | ||||||||
F11A1.3e.2 (12) | |||||||||
F11A1.3e.1 (12) | |||||||||
F11A1.3c.1 (12) | |||||||||
F11A1.3e.4 (12) | |||||||||
F11A1.3f.1 (12) | |||||||||
F11A1.3a.1 (12) | |||||||||
F11A1.3g.1 (12) | |||||||||
F11A1.3e.3 (12) | |||||||||
F11A1.3d.1 (12) | |||||||||
Interactor | WBInteraction000052263 | ||||||||
WBInteraction000052364 | |||||||||
WBInteraction000052424 | |||||||||
WBInteraction000518693 | |||||||||
WBInteraction000518697 | |||||||||
WBInteraction000518698 | |||||||||
WBInteraction000524439 | |||||||||
Genetics | Interpolated_map_position | X | 2.3691 | ||||||
Mapping_data | In_multi_point | 1771 | |||||||
Description | Phenotype | WBPhenotype:0000013 | Paper_evidence | WBPaper00000316 | |||||
WBPaper00000504 | |||||||||
WBPaper00002149 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001171 | Paper_evidence | WBPaper00002149 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mean life span slightly shorter than N2 under same conditions. In control experiments, the life spans were nearly like that of wild type at 15. | Paper_evidence | WBPaper00002149 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00002149 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00002149 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were raised at 15C and placed at 25.5C as L4 larvae or young adults for the life span assay. | Paper_evidence | WBPaper00002149 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 25.5C | Paper_evidence | WBPaper00002149 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001654 | Paper_evidence | WBPaper00026674 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 3 | Paper_evidence | WBPaper00026674 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00003022 | Paper_evidence | WBPaper00026674 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000154 | Paper_evidence | WBPaper00002149 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 15C, 25C | Paper_evidence | WBPaper00002149 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001692 | Paper_evidence | WBPaper00002589 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals were induced by pheromone to display the L2 M37 epitope to the same extent as wildtype e.g. animals exhibit ILD. | Paper_evidence | WBPaper00002589 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | FITC uptake is normal. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00000504 | ||||||||
WBPaper00000932 | |||||||||
WBPaper00002589 | |||||||||
WBPaper00002149 | |||||||||
WBPaper00000316 | |||||||||
WBPaper00016006 | |||||||||
WBPaper00026674 | |||||||||
Method | Substitution_allele |