WormBase Tree Display for Variation: WBVar00088463
expand all nodes | collapse all nodes | view schema
WBVar00088463 | Evidence | Paper_evidence | WBPaper00005760 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ky652 | |||||||
Other_name | CE42267:p.Val16SerfsTer10 | ||||||||
K02E10.8a.1:c.46del | |||||||||
CE33930:p.Val16SerfsTer10 | |||||||||
K02E10.8c.1:c.46del | |||||||||
K02E10.8b.1:c.46del | |||||||||
CE37121:p.Val16SerfsTer10 | |||||||||
HGVSg | CHROMOSOME_X:g.2515264del | ||||||||
Sequence_details | SMap | S_parent | Sequence | R11B5 | |||||
Flanking_sequences | ctattcgttgttgtaactgttggcaagtga | cagttgaaacaacaacaacagtggccaggt | |||||||
Mapping_target | R11B5 | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin (4) | |||||||||
Affects | Gene | WBGene00006365 | |||||||
Transcript | K02E10.8b.1 | VEP_consequence | frameshift_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | K02E10.8b.1:c.46del | ||||||||
HGVSp | CE42267:p.Val16SerfsTer10 | ||||||||
cDNA_position | 60 | ||||||||
CDS_position | 46 | ||||||||
Protein_position | 16 | ||||||||
Exon_number | 2/18 | ||||||||
Codon_change | Gtc/tc | ||||||||
Amino_acid_change | V/X | ||||||||
K02E10.8a.1 | VEP_consequence | frameshift_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | K02E10.8a.1:c.46del | ||||||||
HGVSp | CE37121:p.Val16SerfsTer10 | ||||||||
cDNA_position | 54 | ||||||||
CDS_position | 46 | ||||||||
Protein_position | 16 | ||||||||
Exon_number | 2/18 | ||||||||
Codon_change | Gtc/tc | ||||||||
Amino_acid_change | V/X | ||||||||
K02E10.8c.1 | VEP_consequence | frameshift_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | K02E10.8c.1:c.46del | ||||||||
HGVSp | CE33930:p.Val16SerfsTer10 | ||||||||
cDNA_position | 61 | ||||||||
CDS_position | 46 | ||||||||
Protein_position | 16 | ||||||||
Exon_number | 2/18 | ||||||||
Codon_change | Gtc/tc | ||||||||
Amino_acid_change | V/X | ||||||||
Interactor | WBInteraction000501848 | ||||||||
WBInteraction000502709 | |||||||||
WBInteraction000502711 | |||||||||
WBInteraction000502712 | |||||||||
WBInteraction000502714 | |||||||||
WBInteraction000502716 | |||||||||
Genetics | Interpolated_map_position | X | -14.6831 | ||||||
Mapping_data | In_multi_point | 4716 | |||||||
Description | Phenotype | WBPhenotype:0000181 | Paper_evidence | WBPaper00031671 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | 26% of NSM neurons in syg-1 mutants have a shorter dorsal process and 24% have no dorsal process | Paper_evidence | WBPaper00031671 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00031671 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003666 | PATO:0000460 | Paper_evidence | WBPaper00031671 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | zdIs13 [ tph-1p::GFP] | Paper_evidence | WBPaper00031671 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Disease_info | Models_disease | DOID:1184 | |||||||
Models_disease_in_annotation | WBDOannot00000574 | ||||||||
Reference | WBPaper00031671 | ||||||||
WBPaper00032446 | |||||||||
WBPaper00025644 | |||||||||
Remark | ky652 is associated with a single nucleotide deletion at residue 38263 of cosmid K02E10 | Paper_evidence | WBPaper00005760 | ||||||
Method | Deletion_allele |