WormBase Tree Display for Variation: WBVar00088463
expand all nodes | collapse all nodes | view schema
WBVar00088463 | Evidence | Paper_evidence | WBPaper00005760 | ||
---|---|---|---|---|---|
Name | Public_name | ky652 | |||
Other_name | CE42267:p.Val16SerfsTer10 | ||||
K02E10.8a.1:c.46del | |||||
CE33930:p.Val16SerfsTer10 | |||||
K02E10.8c.1:c.46del | |||||
K02E10.8b.1:c.46del | |||||
CE37121:p.Val16SerfsTer10 | |||||
HGVSg | CHROMOSOME_X:g.2515264del | ||||
Sequence_details | SMap | S_parent | Sequence | R11B5 | |
Flanking_sequences | ctattcgttgttgtaactgttggcaagtga | cagttgaaacaacaacaacagtggccaggt | |||
Mapping_target | R11B5 | ||||
Type_of_mutation | Deletion | ||||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00005219 | ||||
Laboratory | CX | ||||
Status | Live | ||||
Affects | Gene | WBGene00006365 | |||
Transcript | K02E10.8b.1 | VEP_consequence | frameshift_variant | ||
VEP_impact | HIGH | ||||
HGVSc | K02E10.8b.1:c.46del | ||||
HGVSp | CE42267:p.Val16SerfsTer10 | ||||
cDNA_position | 60 | ||||
CDS_position | 46 | ||||
Protein_position | 16 | ||||
Exon_number | 2/18 | ||||
Codon_change | Gtc/tc | ||||
Amino_acid_change | V/X | ||||
K02E10.8a.1 | VEP_consequence | frameshift_variant | |||
VEP_impact | HIGH | ||||
HGVSc | K02E10.8a.1:c.46del | ||||
HGVSp | CE37121:p.Val16SerfsTer10 | ||||
cDNA_position | 54 | ||||
CDS_position | 46 | ||||
Protein_position | 16 | ||||
Exon_number | 2/18 | ||||
Codon_change | Gtc/tc | ||||
Amino_acid_change | V/X | ||||
K02E10.8c.1 | VEP_consequence | frameshift_variant | |||
VEP_impact | HIGH | ||||
HGVSc | K02E10.8c.1:c.46del | ||||
HGVSp | CE33930:p.Val16SerfsTer10 | ||||
cDNA_position | 61 | ||||
CDS_position | 46 | ||||
Protein_position | 16 | ||||
Exon_number | 2/18 | ||||
Codon_change | Gtc/tc | ||||
Amino_acid_change | V/X | ||||
Interactor | WBInteraction000501848 | ||||
WBInteraction000502709 | |||||
WBInteraction000502711 | |||||
WBInteraction000502712 | |||||
WBInteraction000502714 | |||||
WBInteraction000502716 | |||||
Genetics | Interpolated_map_position | X | -14.6831 | ||
Mapping_data | In_multi_point | 4716 | |||
Description (2) | |||||
Disease_info | Models_disease | DOID:1184 | |||
Models_disease_in_annotation | WBDOannot00000574 | ||||
Reference | WBPaper00031671 | ||||
WBPaper00032446 | |||||
WBPaper00025644 | |||||
Remark | ky652 is associated with a single nucleotide deletion at residue 38263 of cosmid K02E10 | Paper_evidence | WBPaper00005760 | ||
Method | Deletion_allele |