WormBase Tree Display for Variation: WBVar00088379
expand all nodes | collapse all nodes | view schema
| WBVar00088379 | Evidence | Paper_evidence | WBPaper00032168 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | kx91 | |||||||
| Other_name | CE43105:p.Gln264Ter | ||||||||
| F59F5.2a.1:c.790C>T | |||||||||
| HGVSg | CHROMOSOME_X:g.10534966C>T | ||||||||
| Sequence_details | SMap | S_parent | Sequence | F59F5 | |||||
| Flanking_sequences | tcgaaatgtgatgcaaacactaagattgag | aggtttgcatagtttgtacactttccttta | |||||||
| Mapping_target | F59F5 | ||||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00032168 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Laboratory | GH | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00010341 | |||||||
| Transcript | F59F5.2a.1 | VEP_consequence | stop_gained,splice_region_variant | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | F59F5.2a.1:c.790C>T | ||||||||
| HGVSp | CE43105:p.Gln264Ter | ||||||||
| cDNA_position | 876 | ||||||||
| CDS_position | 790 | ||||||||
| Protein_position | 264 | ||||||||
| Exon_number | 7/15 | ||||||||
| Codon_change | Cag/Tag | ||||||||
| Amino_acid_change | Q/* | ||||||||
| Genetics | Interpolated_map_position | X | 2.22603 | ||||||
| Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00025094 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | 13-30% embryonic lethal | Paper_evidence | WBPaper00025094 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Recessive | Paper_evidence | WBPaper00025094 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00025094 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000054 | Paper_evidence | WBPaper00025094 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | 38-57% larval inviablity | Paper_evidence | WBPaper00025094 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Recessive | Paper_evidence | WBPaper00025094 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000023 | PATO:0000460 | Paper_evidence | WBPaper00025094 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000706 | Paper_evidence | WBPaper00032168 | |||||||
| WBPaper00025094 | |||||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPerson2021 | |||||||||
| Remark | Class I allele. Animals lack autofluorescent gut granules in anterior intestinal cells, however not in posterior adult intestinal cells. | Paper_evidence | WBPaper00032168 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Embryos had relatively few gut granules in their intestinal cells. Birefringent material in the intestinal lumen was expelled as newly hatched mutant larvae defecated, and larvae and adult animals had few autofluorescent and acidified gut granules | Paper_evidence | WBPaper00025094 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Recessive | Paper_evidence | WBPaper00032168 | |||||||
| WBPaper00025094 | |||||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPerson2021 | |||||||||
| Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032168 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00025094 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00025094 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Maternal | With_maternal_effect | Paper_evidence | WBPaper00032168 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Treatment | Staining with LysoTracker Red and acridine orange | Paper_evidence | WBPaper00025094 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Reference | WBPaper00025094 | ||||||||
| WBPaper00032168 | |||||||||
| Method | Substitution_allele |
