WormBase Tree Display for Variation: WBVar00088347
expand all nodes | collapse all nodes | view schema
WBVar00088347 | Evidence | Paper_evidence | WBPaper00003386 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ku241 | |||||||
Other_name (11) | |||||||||
HGVSg | CHROMOSOME_X:g.5672227G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | W01C8 | |||||
Flanking_sequences | caacaataaagtcatgtggcctatggttca | atgctccatgccggcaatttcgactcggag | |||||||
Mapping_target | W01C8 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | MH | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001182 | |||||||
Transcript (10) | |||||||||
Genetics | Interpolated_map_position | X | -4.40704 | ||||||
Description | Phenotype (8) | ||||||||
Phenotype_not_observed | WBPhenotype:0000688 | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 0% (n=76) of animals produce no progeny. | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00003386 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00003386 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001414 | Paper_evidence | WBPaper00003386 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00003386 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00003386 | ||||||||
WBPaper00006298 | |||||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00001182 Acceptor | ||||||||
Method | Substitution_allele |