WormBase Tree Display for Variation: WBVar00088345
expand all nodes | collapse all nodes | view schema
WBVar00088345 | Name | Public_name | ku233 | ||||
---|---|---|---|---|---|---|---|
Sequence_details | SMap | S_parent | Sequence | Y55B1BR | |||
Flanking_sequences | ctcggttaaacaaggcgtgcggcggagtgt | ttgcaaggaaatttgaatttaaattttatt | |||||
Mapping_target | Y55B1BR | ||||||
Type_of_mutation | Substitution | cg | aa | Paper_evidence | WBPaper00024252 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin (4) | |||||||
Affects | Gene | WBGene00003134 | |||||
Genetics | Interpolated_map_position | III | -26.8428 | ||||
Description | Phenotype (6) | ||||||
Reference | WBPaper00024252 | ||||||
WBPaper00019721 | |||||||
WBPaper00018142 | |||||||
WBPaper00015695 | |||||||
WBPaper00023148 | |||||||
WBPaper00010291 | |||||||
Remark | Allele affects a conserved element upstream of the mat-3 operon. | Paper_evidence | WBPaper00024252 | ||||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00003134 Genomic_neighbourhood | Paper_evidence | WBPaper00024252 | |||||
Method | Substitution_allele |