WormBase Tree Display for Variation: WBVar00088333
expand all nodes | collapse all nodes | view schema
WBVar00088333 | Evidence | Paper_evidence | WBPaper00003386 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ku194 | |||||||
Other_name (17) | |||||||||
HGVSg | CHROMOSOME_X:g.5672291C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | W01C8 | |||||
Flanking_sequences | ctcctgaggcagcacgaactgatgcagcat | agcagcaacaaatgataattgctaacatgt | |||||||
Mapping_target | W01C8 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00003386 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin (4) | |||||||||
Affects | Gene | WBGene00001182 | |||||||
Transcript (11) | |||||||||
Interactor | WBInteraction000501481 | ||||||||
WBInteraction000501482 | |||||||||
WBInteraction000501869 | |||||||||
WBInteraction000520308 | |||||||||
WBInteraction000555306 | |||||||||
Genetics | Interpolated_map_position | X | -4.407 | ||||||
Description | Phenotype (13) | ||||||||
Phenotype_not_observed | WBPhenotype:0000197 | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | pi cell precursors adopt a pi fate, as assayed by their division patterns (56/63 cells lineaged) and the expression of pi-cell specific markers lin-11::gfp and cog-2::gfp in ku194 animals. | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype (2) | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007813 | PATO:0000460 | Paper_evidence | WBPaper00003386 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001414 | Paper_evidence | WBPaper00003386 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00003386 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00042395 | ||||||||
WBPaper00003386 | |||||||||
WBPaper00006298 | |||||||||
Method | Substitution_allele |