WormBase Tree Display for Variation: WBVar00088322
expand all nodes | collapse all nodes | view schema
WBVar00088322 | Evidence | Paper_evidence | WBPaper00002150 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ku114 | |||||||
Other_name | Y54E10BL.6.1:c.711C>T | ||||||||
CE25437:p.Pro237= | |||||||||
HGVSg | CHROMOSOME_I:g.3007931G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y54E10BL | |||||
Flanking_sequences | atttatcttttaaaaaattcaaatttcagcc | gaacgactcacaggatcccactatacaatt | |||||||
Mapping_target | Y54E10BL | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00002150 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin (4) | |||||||||
Affects | Gene | WBGene00003186 | |||||||
Transcript | Y54E10BL.6.1 | VEP_consequence | splice_region_variant,synonymous_variant | ||||||
VEP_impact | LOW | ||||||||
HGVSc | Y54E10BL.6.1:c.711C>T | ||||||||
HGVSp | CE25437:p.Pro237= | ||||||||
cDNA_position | 714 | ||||||||
CDS_position | 711 | ||||||||
Protein_position | 237 | ||||||||
Exon_number | 7/9 | ||||||||
Codon_change | ccC/ccT | ||||||||
Amino_acid_change | P | ||||||||
Interactor | WBInteraction000519075 | ||||||||
WBInteraction000524417 | |||||||||
Genetics | Interpolated_map_position | I | -5.23812 | ||||||
Description | Phenotype | WBPhenotype:0001645 | Paper_evidence | WBPaper00005245 | |||||
WBPaper00006119 | |||||||||
WBPaper00029116 | |||||||||
Curator_confirmed | WBPerson1754 | ||||||||
Remark | Mutation blocks muscle protein degradation increase in let-60(ga89) animals | Paper_evidence | WBPaper00005245 | ||||||
Curator_confirmed | WBPerson1754 | ||||||||
Blocks muscle protein degradation induced by clr-1(e1745) | Paper_evidence | WBPaper00006119 | |||||||
Curator_confirmed | WBPerson1754 | ||||||||
Blocks protein degradation in response to treatment with the AGE-1 inhibitor LY-294002 | Paper_evidence | WBPaper00029116 | |||||||
Curator_confirmed | WBPerson1754 | ||||||||
Affected_by | Molecule | WBMol:00005384 | Paper_evidence | WBPaper00029116 | |||||
Curator_confirmed | WBPerson1754 | ||||||||
Phenotype_assay | Genotype | let-60(ga89) | Paper_evidence | WBPaper00005245 | |||||
Curator_confirmed | WBPerson1754 | ||||||||
clr-1(e1745) | Paper_evidence | WBPaper00006119 | |||||||
Curator_confirmed | WBPerson1754 | ||||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | viable | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001060 | Paper_evidence | WBPaper00003955 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00001063 | Paper_evidence | WBPaper00003955 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005672 | PATO:0000460 | Paper_evidence | WBPaper00003955 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (9) | |||||||||
Method | Substitution_allele |