WormBase Tree Display for Variation: WBVar00088322
expand all nodes | collapse all nodes | view schema
WBVar00088322 | Evidence | Paper_evidence | WBPaper00002150 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ku114 | ||||||
Other_name | Y54E10BL.6.1:c.711C>T | |||||||
CE25437:p.Pro237= | ||||||||
HGVSg | CHROMOSOME_I:g.3007931G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | Y54E10BL | ||||
Flanking_sequences | atttatcttttaaaaaattcaaatttcagcc | gaacgactcacaggatcccactatacaatt | ||||||
Mapping_target | Y54E10BL | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00002150 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin (4) | ||||||||
Affects | Gene | WBGene00003186 | ||||||
Transcript | Y54E10BL.6.1 | VEP_consequence | splice_region_variant,synonymous_variant | |||||
VEP_impact | LOW | |||||||
HGVSc | Y54E10BL.6.1:c.711C>T | |||||||
HGVSp | CE25437:p.Pro237= | |||||||
cDNA_position | 714 | |||||||
CDS_position | 711 | |||||||
Protein_position | 237 | |||||||
Exon_number | 7/9 | |||||||
Codon_change | ccC/ccT | |||||||
Amino_acid_change | P | |||||||
Interactor | WBInteraction000519075 | |||||||
WBInteraction000524417 | ||||||||
Genetics | Interpolated_map_position | I | -5.23812 | |||||
Description | Phenotype | WBPhenotype:0001645 | Paper_evidence | WBPaper00005245 | ||||
WBPaper00006119 | ||||||||
WBPaper00029116 | ||||||||
Curator_confirmed | WBPerson1754 | |||||||
Remark | Mutation blocks muscle protein degradation increase in let-60(ga89) animals | Paper_evidence | WBPaper00005245 | |||||
Curator_confirmed | WBPerson1754 | |||||||
Blocks muscle protein degradation induced by clr-1(e1745) | Paper_evidence | WBPaper00006119 | ||||||
Curator_confirmed | WBPerson1754 | |||||||
Blocks protein degradation in response to treatment with the AGE-1 inhibitor LY-294002 | Paper_evidence | WBPaper00029116 | ||||||
Curator_confirmed | WBPerson1754 | |||||||
Affected_by | Molecule | WBMol:00005384 | Paper_evidence | WBPaper00029116 | ||||
Curator_confirmed | WBPerson1754 | |||||||
Phenotype_assay | Genotype | let-60(ga89) | Paper_evidence | WBPaper00005245 | ||||
Curator_confirmed | WBPerson1754 | |||||||
clr-1(e1745) | Paper_evidence | WBPaper00006119 | ||||||
Curator_confirmed | WBPerson1754 | |||||||
Phenotype_not_observed (2) | ||||||||
Reference | WBPaper00029116 | |||||||
WBPaper00015792 | ||||||||
WBPaper00006119 | ||||||||
WBPaper00015779 | ||||||||
WBPaper00005245 | ||||||||
WBPaper00003955 | ||||||||
WBPaper00015066 | ||||||||
WBPaper00022141 | ||||||||
WBPaper00025469 | ||||||||
Method | Substitution_allele |