WormBase Tree Display for Variation: WBVar00087782
expand all nodes | collapse all nodes | view schema
WBVar00087782 | Evidence | Paper_evidence | WBPaper00003351 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | hc81 | |||||||
Other_name | CE06618:p.Gln116Ter | ||||||||
ZK524.1.1:c.346C>T | |||||||||
HGVSg | CHROMOSOME_I:g.7455441C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | ZK524 | |||||
Flanking_sequences | tgtcttttgatattgtttggggtatccgcg | agactcttcatgatatgttttcacaagtat | |||||||
Mapping_target | ZK524 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00003351 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | BA | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00004958 | |||||||
Transcript | ZK524.1.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK524.1.1:c.346C>T | ||||||||
HGVSp | CE06618:p.Gln116Ter | ||||||||
cDNA_position | 400 | ||||||||
CDS_position | 346 | ||||||||
Protein_position | 116 | ||||||||
Exon_number | 3/10 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
Genetics | Interpolated_map_position | I | 2.09248 | ||||||
Description | Phenotype | WBPhenotype:0000186 | Paper_evidence | WBPaper00001075 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Hermaphrodites lay fewer oocytes than wild type | Paper_evidence | WBPaper00001075 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001075 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001075 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 16C | Paper_evidence | WBPaper00001075 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000290 | Paper_evidence | WBPaper00001075 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No sperm or haploid nuclei are observed after DAPI staining of the adult reproductive tract of hermaphrodites | Paper_evidence | WBPaper00001075 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001075 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001075 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 16C | Paper_evidence | WBPaper00001075 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000357 | Paper_evidence | WBPaper00001075 | |||||||
WBPaper00001612 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson725 | |||||||||
Remark | Hermaphrodites are self-sterile because they make defective sperm. Oocytes are cross fertile with wild type sperm. | Paper_evidence | WBPaper00001612 | ||||||
Curator_confirmed | WBPerson725 | ||||||||
Recessive | Paper_evidence | WBPaper00001075 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001075 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 16C | Paper_evidence | WBPaper00001075 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000417 | Paper_evidence | WBPaper00001612 | |||||||
Curator_confirmed | WBPerson725 | ||||||||
Remark | Specific to only spermatogenesis | Paper_evidence | WBPaper00001612 | ||||||
Curator_confirmed | WBPerson725 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006799 | PATO:0000460 | Paper_evidence | WBPaper00001612 | ||||
Curator_confirmed | WBPerson725 | ||||||||
GO_term | GO:0007283 | PATO:0000460 | Paper_evidence | WBPaper00001612 | |||||
Curator_confirmed | WBPerson725 | ||||||||
WBPhenotype:0000692 | Paper_evidence | WBPaper00001612 | |||||||
Curator_confirmed | WBPerson725 | ||||||||
Remark | spe-4 males are cross-sterile | Paper_evidence | WBPaper00001612 | ||||||
Curator_confirmed | WBPerson725 | ||||||||
WBPhenotype:0000981 | Paper_evidence | WBPaper00001075 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Spermatocytes differ from wild type because they have completed the nuclear events of meiosis and have four haploid nuclei in syncytium | Paper_evidence | WBPaper00001075 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001075 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001075 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 16C | Paper_evidence | WBPaper00001075 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000982 | Paper_evidence | WBPaper00001075 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Spermatogenesis in males arrests during development of spermatids from spermatocytes | Paper_evidence | WBPaper00001075 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001075 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001075 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 16C | Paper_evidence | WBPaper00001075 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001360 | Paper_evidence | WBPaper00001075 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001075 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001075 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 16C | Paper_evidence | WBPaper00001075 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001683 | Paper_evidence | WBPaper00001612 | |||||||
Curator_confirmed | WBPerson725 | ||||||||
Remark | meiosis is completed but all four nuclei are in one arrested, abnormal spermatocyte. This is a completely penetrant phenotype and self-sterility is 100%. | Paper_evidence | WBPaper00001612 | ||||||
Curator_confirmed | WBPerson725 | ||||||||
EQ_annotations | GO_term | GO:0007283 | PATO:0000460 | Paper_evidence | WBPaper00001612 | ||||
Curator_confirmed | WBPerson725 | ||||||||
WBPhenotype:0002386 | Paper_evidence | WBPaper00001612 | |||||||
Curator_confirmed | WBPerson725 | ||||||||
Remark | Fibrous bodies are not associated with membranous organelles. | Paper_evidence | WBPaper00001612 | ||||||
Curator_confirmed | WBPerson725 | ||||||||
Reference | WBPaper00001612 | ||||||||
WBPaper00001075 | |||||||||
WBPaper00021640 | |||||||||
Method | Substitution_allele |