WormBase Tree Display for Variation: WBVar00087752
expand all nodes | collapse all nodes | view schema
WBVar00087752 | Evidence | Paper_evidence | WBPaper00002791 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | hc24 | |||||||
Other_name | CE42470:p.Leu1682Phe | ||||||||
F43G9.6b.1:c.5044C>T | |||||||||
CE10364:p.Leu1809Phe | |||||||||
F43G9.6a.1:c.5425C>T | |||||||||
HGVSg | CHROMOSOME_I:g.8623979G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F43G9 | |||||
Flanking_sequences | tgggataagaacaagttccgcaaggatcgt | ttctcggtgacattgaactggatcttctcg | |||||||
Mapping_target | F43G9 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00002791 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00000366 | ||||||||
Laboratory | BA | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001414 | |||||||
Transcript | F43G9.6a.1 (12) | ||||||||
F43G9.6b.1 (12) | |||||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00002791 | |||||
Genetics | Interpolated_map_position | I | 3.00219 | ||||||
Description | Phenotype | WBPhenotype:0000017 | Paper_evidence | WBPaper00044487 | |||||
Curator_confirmed | WBPerson2369 | ||||||||
Remark | Figure 1 | Paper_evidence | WBPaper00044487 | ||||||
Curator_confirmed | WBPerson2369 | ||||||||
Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00044487 | |||||
Curator_confirmed | WBPerson2369 | ||||||||
WBPhenotype:0000357 | Paper_evidence | WBPaper00001075 | |||||||
WBPaper00000495 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | At the permissive temperature, ts mutants produced 100 to 300 progeny and less than 65 unfertilized eggs, which were laid late in the life cycle, like those of wild-type hermaphrodites. At the restrictive temperature of 25 deg C, animals produced only a few progeny and laid 72 to 282 unfertilized eggs. | Paper_evidence | WBPaper00000495 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00000495 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00001075 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00001075 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001075 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00001075 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
25 | Paper_evidence | WBPaper00000495 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000421 | Paper_evidence | WBPaper00044487 | |||||||
Curator_confirmed | WBPerson2369 | ||||||||
Remark | Figure 1 | Paper_evidence | WBPaper00044487 | ||||||
Curator_confirmed | WBPerson2369 | ||||||||
Affected_by | Molecule | WBMol:00004019 | Paper_evidence | WBPaper00044487 | |||||
Curator_confirmed | WBPerson2369 | ||||||||
WBPhenotype:0000509 | Paper_evidence | WBPaper00001075 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Infertile spermatozoa with stubby motile pseudopods | Paper_evidence | WBPaper00001075 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001075 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00001075 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00001075 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00001075 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00000495 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | At the permissive temperature, ts mutants produced 100 to 300 progeny and less than 65 unfertilized eggs, which were laid late in the life cycle, like those of wild-type hermaphrodites. At the restrictive temperature of 25 deg C, animals produced only a few progeny and laid 72 to 282 unfertilized eggs. | Paper_evidence | WBPaper00000495 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00000495 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00000495 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000806 | Paper_evidence | WBPaper00000495 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals are fertilization defective. Animals have a short (5-10 hrs) temperature sensitive period (TSP) late in their development. | Paper_evidence | WBPaper00000495 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00000495 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00000495 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000863 | Paper_evidence | WBPaper00000495 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males are ts sterile, producing less progeny at restrictive temperatures. | Paper_evidence | WBPaper00000495 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00000495 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00000495 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001360 | Paper_evidence | WBPaper00001075 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001075 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00001075 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001075 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00001075 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001720 | Paper_evidence | WBPaper00000495 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Nonfunctional sperm of fer hermaphrodites are progressively lost fro the spermathecae of mutant hermaphrodites. by the time 40-70 oocytes have passed through the spermathecae of sterile hermaphrodites, most of the sperm have been swept out rather than migrating back through the spermathecal valve. | Paper_evidence | WBPaper00000495 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00000495 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000033 | Paper_evidence | WBPaper00000495 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals grow and develop at the same rate as wild type, initiating egg laying at 45 hr post-hatching, as do N2 hermaphrodites. | Paper_evidence | WBPaper00000495 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000186 | Paper_evidence | WBPaper00000495 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Oocytes are produced and are capable of being fertilized. | Paper_evidence | WBPaper00000495 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000670 | Paper_evidence | WBPaper00000495 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | At the start of their egg-laying period, 45 hr post-hatching at 25 deg C, the spermathecae of these hermaphrodites contain over 170 sperm. | Paper_evidence | WBPaper00000495 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000676 | Paper_evidence | WBPaper00000495 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals grow and develop at the same rate as wild type, initiating egg laying at 45 hr post-hatching, as do N2 hermaphrodites. | Paper_evidence | WBPaper00000495 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Disease_info | Models_disease | DOID:11724 | |||||||
Models_disease_in_annotation | WBDOannot00001030 | ||||||||
WBDOannot00001031 | |||||||||
WBDOannot00001032 | |||||||||
Reference | WBPaper00001075 | ||||||||
WBPaper00000495 | |||||||||
WBPaper00015989 | |||||||||
WBPaper00044487 | |||||||||
Method | Substitution_allele |