WormBase Tree Display for Variation: WBVar00017601
expand all nodes | collapse all nodes | view schema
WBVar00017601 | Name | Public_name | g320 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | pas15117 | |||||||
snp_C39E6[4] | ||||||||
haw102580 | ||||||||
LSJ2_238 | ||||||||
oicr_ce77 | ||||||||
cewivar00056234 | ||||||||
C39E6.6.1:c.643G>T | ||||||||
CE06941:p.Val215Phe | ||||||||
HGVSg | CHROMOSOME_X:g.4768788C>A | |||||||
Sequence_details | SMap | S_parent | Sequence | C39E6 | ||||
Flanking_sequences | accatggtaactaggattgacgttgttctaaaacacaaatagtatttcggttagaaaccttgcatttaataccttctgttctgaagtacaactcgttgtttctccttttcctgtttgtctagaaattcgttcaactggaacgaaatcaaatgtgaatttttaatttgaaaatcaataaaactacctcattttcatactgttcaagaccatgcgacgggaatgcgcaagagctctccaacgcgcttgttctctccaccattttgcgtatctttgtctgagcacgcttgctgagcaccgaaa | aatatttgcatagcagaaggccatgacagcgaatgggaccacgaattgggcgagcatcacgatcattgtgtaggctcttctagacttggcagattcccacttttcagtgcaaaagtagccgcatattctctcttcctgaaacgagggtactagttgtataagaagttgaatacctagaaaaaaacgacactcactgtgtattcaatcatttgcatattgaacgcatagggtagagttacaacaaaagagaggatccacaatagaacagtagtaagaaatgctcctctttgggatagtggt | ||||||
Mapping_target | C39E6 | |||||||
Type_of_mutation | Substitution | C | A | |||||
SeqStatus | Sequenced | |||||||
Variation_type | SNP | |||||||
Predicted_SNP | ||||||||
Natural_variant | ||||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (45) | ||||||||
Laboratory | AX | |||||||
RW | ||||||||
CX | ||||||||
RC | ||||||||
Person (2) | ||||||||
Analysis | WGS_Pasadena_Quinlan | |||||||
WGS_De_Bono | ||||||||
WGS_McGrath | ||||||||
WGS_Stein | ||||||||
Million_mutation_project_reanalysis | ||||||||
SNP_Wicks | ||||||||
WGS_Hawaiian_Waterston | ||||||||
History | Acquires_merge | WBVar00145397 | ||||||
WBVar00243575 | ||||||||
WBVar00078220 | ||||||||
WBVar01340258 | ||||||||
WBVar00601519 | ||||||||
WBVar00601658 | ||||||||
WBVar01473648 | ||||||||
WBVar01473880 | ||||||||
WBVar01473895 | ||||||||
WBVar02125007 | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00003807 | ||||||
Transcript | C39E6.6.1 (12) | |||||||
Genetics | Mapping_data | 2_point (2) | ||||||
Description | Phenotype | WBPhenotype:0000219 | Paper_evidence | WBPaper00040608 | ||||
Curator_confirmed | WBPerson6405 | |||||||
Remark | In a let-23(sy1) background, npr-1(g320) further reduced vulval cell induction compared to N2 allele at npr-1. | Paper_evidence | WBPaper00040608 | |||||
Curator_confirmed | WBPerson6405 | |||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00040608 | |||||
Curator_confirmed | WBPerson6405 | |||||||
Variation_effect | Wild_allele | Paper_evidence | WBPaper00040608 | |||||
Curator_confirmed | WBPerson6405 | |||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00040608 | |||||
Curator_confirmed | WBPerson6405 | |||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00040608 | ||||
Curator_confirmed | WBPerson6405 | |||||||
Genotype | let-23(sy1) | Paper_evidence | WBPaper00040608 | |||||
Curator_confirmed | WBPerson6405 | |||||||
WBPhenotype:0000660 | Paper_evidence | WBPaper00003187 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals are social foragers and aggregate in clumps in the presence of food. | Paper_evidence | WBPaper00003187 | |||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00003187 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Wild_allele | Paper_evidence | WBPaper00003187 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Animals were assayed on a bacterial lawn. | Paper_evidence | WBPaper00003187 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000662 | Paper_evidence | WBPaper00003187 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals moved more quickly on food than solitary foragers even though in the absence of food, both social and solitary foragers moved at similar rapid speeds. When moving on food, social animals made long forays at speeds of ~190um/s until they joined a clump, at which point they reduced their speed and reversed frequently. Strength of hyperactivity on food ad609 > ky13, n1353 > g320. | Paper_evidence | WBPaper00003187 | |||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00003187 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Wild_allele | Paper_evidence | WBPaper00003187 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001013 | Paper_evidence | WBPaper00032196 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals were more susceptible to infection by P. aeruginosa, S. enterica and E. faecalis than N2 animals. | Paper_evidence | WBPaper00032196 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Strain | WBStrain00005497 | Paper_evidence | WBPaper00032196 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001524 | Paper_evidence | WBPaper00051410 | ||||||
Curator_confirmed | WBPerson38423 | |||||||
Remark | Low oxygen concentration promotes quiescence in npr-1 mutant animals. (Fig 1) | Paper_evidence | WBPaper00051410 | |||||
Curator_confirmed | WBPerson38423 | |||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00051410 | ||||
Curator_confirmed | WBPerson38423 | |||||||
WBPhenotype:0001764 | Paper_evidence | WBPaper00031935 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animal CO2 responses in the crossed gradient depended on context. On food, the behavior of these animals was dominated by the O2 response: animals ignored high CO2 to accumulate at low O2; conversely, off food it was the response to CO2 that dominated:animals behaved as if they were in a gradient that consisted only of CO2. The response of N2 animals was dominated by CO2 avoidance: both on and off food animals accumulated at 21% O2 / 0% CO2. | Paper_evidence | WBPaper00031935 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Wild_allele | Paper_evidence | WBPaper00031935 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Animals were placed in a combined gradients of O2 and CO2 with 11%O2 and 5% CO2 at one end of the chamber and 21% O2 and 0% CO2 at the other. Strains were maintained at 22C. | Paper_evidence | WBPaper00031935 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00031935 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals showed reduced avoidance to 5% carbon dioxide in the presence of food. However, in the absence of food, animals responded with an avoidance response similar to N2. | Paper_evidence | WBPaper00031935 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Wild_allele | Paper_evidence | WBPaper00031935 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Strains were maintained at 22C. | Paper_evidence | WBPaper00031935 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001820 | Paper_evidence | WBPaper00003187 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | More than 95% of the animals accumulated at the border. | Paper_evidence | WBPaper00003187 | |||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00003187 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Wild_allele | Paper_evidence | WBPaper00003187 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Animals were assayed on a bacterial lawn. | Paper_evidence | WBPaper00003187 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference (11) | ||||||||
Method | WGS_Pasadena_Quinlan |