WormBase Tree Display for Variation: WBVar00000664
expand all nodes | collapse all nodes | view schema
WBVar00000664 | Evidence | Paper_evidence | WBPaper00032072 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | bz301 | |||||||
Other_name | T01C8.7.1:c.446C>T | ||||||||
CE39109:p.Ala149Val | |||||||||
HGVSg | CHROMOSOME_X:g.16806262G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F41G4 | |||||
Flanking_sequences | cttactgagcttttttatttccagacactg | accttttccagcaattacgctttgtaattt | |||||||
Mapping_target | F41G4 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00032072 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | ZB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003168 | |||||||
Transcript | T01C8.7.1 (12) | ||||||||
Genetics | Interpolated_map_position | X | 24.0629 | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000179 | Paper_evidence | WBPaper00032072 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Neurotoxicity was not conferred in the absence of Ismec-10(d). In the presence of lsmec-10(d) however, touch cell neurons died, only AVM and PVM survived. The mutation acted semi-dominantly to enhance neuronal loss in lsmec-10(d) animals. | Paper_evidence | WBPaper00032072 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Semi_dominant | Paper_evidence | WBPaper00032072 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005237 | PATO:0000460 | Paper_evidence | WBPaper00032072 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00032072 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | mec-10(+) or zdIs5[pmec-4GFP] I; bzIs67[mec-10(d)] | Paper_evidence | WBPaper00032072 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000315 | Paper_evidence | WBPaper00032072 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Touch responses were normal. In the presence of lsmec-10(d), touch cell responses were impaired. | Paper_evidence | WBPaper00032072 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Semi_dominant | Paper_evidence | WBPaper00032072 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005237 | PATO:0000460 | Paper_evidence | WBPaper00032072 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00032072 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | mec-10(+) or zdIs5[pmec-4GFP] I; bzIs67[mec-10(d)] | Paper_evidence | WBPaper00032072 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001397 | Paper_evidence | WBPaper00032072 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Neurotoxicity was not conferred in the absence of Ismec-10(d). In the presence of lsmec-10(d) however, touch cell neurons died, only AVM and PVM survived. The mutation acted semi-dominantly to enhance neuronal loss in lsmec-10(d) animals. Onset of necrosis may be after L1 stage. | Paper_evidence | WBPaper00032072 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Semi_dominant | Paper_evidence | WBPaper00032072 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005237 | PATO:0000460 | Paper_evidence | WBPaper00032072 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00032072 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00032072 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | mec-10(+) or zdIs5[pmec-4GFP] I; bzIs67[mec-10(d)] | Paper_evidence | WBPaper00032072 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00032072 | ||||||||
Method | Substitution_allele |