WormBase Tree Display for Variation: WBVar00000460
expand all nodes | collapse all nodes | view schema
WBVar00000460 | Evidence | Paper_evidence | WBPaper00048626 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | bn2 | ||||||
Other_name | CE24685:p.Gly296Asp | |||||||
Y87G2A.5.1:c.887G>A | ||||||||
HGVSg | CHROMOSOME_I:g.13556729C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | Y87G2A | ||||
Flanking_sequences | tgcccggatacgataaaaaaatcgaattcg | cgtgctcaactcgttcgcctacaagattca | ||||||
Mapping_target | Y87G2A | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00048626 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin (5) | ||||||||
Linked_to | WBVar02144875 | |||||||
WBVar02144876 | ||||||||
WBVar02144874 | ||||||||
Affects | Gene | WBGene00006936 | ||||||
Transcript | Y87G2A.5.1 (12) | |||||||
Interactor (18) | ||||||||
Genetics | Gene_class | glp | ||||||
Interpolated_map_position | I | 21.4559 | ||||||
Mapping_data (3) | ||||||||
Description | Phenotype (19) | |||||||
Phenotype_not_observed | WBPhenotype:0001182 | Paper_evidence | WBPaper00032310 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | glp-4(bn2ts) mutants exhibited normal fat content at the permissive temperature of 15 degrees Celsius, compared to wild type controls, as determined by Nile Red staining (Figure S3C,D) | Paper_evidence | WBPaper00032310 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Temperature | 15 | Paper_evidence | WBPaper00032310 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001266 | Paper_evidence | WBPaper00035490 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Nematodes containing a mutation in either glp-1 or glp-4 did not have substantially more phospho-PMK-1 than did wild-type nematodes | Paper_evidence | WBPaper00035490 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0002534 | Paper_evidence | WBPaper00005130 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | The accumulation of both abf-1 and abf-2 transcripts was almost identical in adults of N2 and glp-4(bn2), and the eggs. | Paper_evidence | WBPaper00005130 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference (36) | ||||||||
Method | Substitution_allele |