WormBase Tree Display for Variation: WBVar00000425
expand all nodes | collapse all nodes | view schema
WBVar00000425 | Evidence | Paper_evidence | WBPaper00003831 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | b1026 | |||||||
Other_name | CE22368:p.Gly493Glu | ||||||||
CE49356:p.Gly414Glu | |||||||||
T11F8.3b.1:c.1241G>A | |||||||||
T11F8.3a.1:c.1478G>A | |||||||||
HGVSg | CHROMOSOME_IV:g.5471646G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | T11F8 | |||||
Flanking_sequences | tgattcttacagctccatctccaagcgctg | gatttccatctgcacaatgagcggaatgtt | |||||||
Mapping_target | T11F8 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003831 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | DH | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00004374 | |||||||
Transcript | T11F8.3b.1 (12) | ||||||||
T11F8.3a.1 (12) | |||||||||
Genetics | Interpolated_map_position | IV | 1.68705 | ||||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00003831 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Most embryos failed to hatch, viability 23%. Escapers proceeded through normal larval development and produced animals with similar defects. | Paper_evidence | WBPaper00003831 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00003831 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00003831 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals had reduced embryo production. | Paper_evidence | WBPaper00003831 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00003831 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00003831 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals lacked defined RME-2 localization at the oocyte plasma membrane. | Paper_evidence | WBPaper00003831 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006797 | PATO:0000460 | Paper_evidence | WBPaper00003831 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005175 | PATO:0000460 | Paper_evidence | WBPaper00003831 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000668 | Paper_evidence | WBPaper00003831 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | A high percentage of gonad arms contained one endomitotic-like oocyte proximal to the spermatheca. | Paper_evidence | WBPaper00003831 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000978 | Paper_evidence | WBPaper00003831 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Time-lapse video recordings of ovulations indicated frequent failure of spermathecal dilation as well as common premature closure, which breaks oocytes into fragments as they pass. | Paper_evidence | WBPaper00003831 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001260 | Paper_evidence | WBPaper00003831 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Oocytes were morphologically wild-type although slightly small and devoid of yolk. | Paper_evidence | WBPaper00003831 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006797 | PATO:0000460 | Paper_evidence | WBPaper00003831 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001762 | Paper_evidence | WBPaper00003831 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | YP170::GFP protein flourescence, a full length yolk protein fusion, was devoid in oocytes. | Paper_evidence | WBPaper00003831 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | YP170::GFP | Paper_evidence | WBPaper00003831 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000120 | Paper_evidence | WBPaper00003831 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited abundant cytoplasmic immunostaining with both anti-RME-2 antisera. | Paper_evidence | WBPaper00003831 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006797 | PATO:0000460 | Paper_evidence | WBPaper00003831 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000812 | Paper_evidence | WBPaper00003831 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited normal germ line morphology. | Paper_evidence | WBPaper00003831 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00003831 | ||||||||
Method | Substitution_allele |