WormBase Tree Display for Variation: WBVar00000337
expand all nodes | collapse all nodes | view schema
WBVar00000337 | Evidence | Paper_evidence | WBPaper00005955 | |
---|---|---|---|---|
Name | Public_name | ay48 | ||
Other_name | Y37D8A.13.1:c.2705C>T | |||
CE20217:p.Pro902Leu | ||||
HGVSg | CHROMOSOME_III:g.12881617G>A | |||
Sequence_details (5) | ||||
Variation_type | Allele | |||
Origin | Species | Caenorhabditis elegans | ||
Laboratory | NH | |||
Status | Live | |||
Affects | Gene | WBGene00006804 | ||
Transcript | Y37D8A.13.1 (12) | |||
Genetics | Interpolated_map_position | III | 19.2531 | |
Reference | WBPaper00005955 | |||
Remark | In addition to the curated lesion, ay48 also carries a c -> t substitution resulting in a Q(948)Ochre mutation with flanking sequences of cgatgaatcgccatctccgttctctgatcat & aaagtttcaccactggaattggaatcggag | Curator_confirmed | WBPerson1845 | |
ay48 is a Q(948) to stop mutation | Paper_evidence | WBPaper00005955 | ||
[190909 pad] Shifted the substitution 1bp to make the P->L codon change possible. | Curator_confirmed | WBPerson1983 | ||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006804 Missense 902 P to L | Paper_evidence | WBPaper00005955 | ||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006804 Ochre_UAA Q(948) to stop | Paper_evidence | WBPaper00005955 | ||
Method | Substitution_allele |