WormBase Tree Display for Variation: WBVar00000195
expand all nodes | collapse all nodes | view schema
WBVar00000195 | Name | Public_name | ar105 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F29G9.4b.1:c.355C>T | |||||||
F29G9.4a.3:c.-54C>T | ||||||||
F29G9.4a.1:c.-54C>T | ||||||||
F29G9.4a.5:c.-54C>T | ||||||||
F29G9.4a.4:c.-54C>T | ||||||||
CE39151:p.Gln119Ter | ||||||||
F29G9.4a.2:c.-54C>T | ||||||||
HGVSg | CHROMOSOME_V:g.6011242C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | F29G9 | ||||
Flanking_sequences | tcaggtccgatcccagcaatcccgactaat | aaatctacaatcgaacattcaccgatttct | ||||||
Mapping_target | F29G9 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00026611 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00008001 | |||||||
Laboratory | GS | |||||||
Status | Live | |||||||
Affects (3) | ||||||||
Genetics | Interpolated_map_position | V | -0.460696 | |||||
Description | Phenotype (9) | |||||||
Phenotype_not_observed | WBPhenotype:0000104 | Paper_evidence | WBPaper00033081 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Polarity is normal in all mutants | Paper_evidence | WBPaper00033081 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Genotype | kuIs47 [AJM-1::GFP] | Paper_evidence | WBPaper00033081 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000220 | Paper_evidence | WBPaper00033081 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | zmp-1 and lin-3 markers are expressed in the correct cell at the expected time in all mutants | Paper_evidence | WBPaper00033081 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Genotype | syIs107[lin-3(delta-pes-10)::GFP], syIs49[zmp- 1::GFP] | Paper_evidence | WBPaper00033081 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00032446 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | MIG-2::GFP, marking the invasive membrane, was localized normally in fos-1a mutants | Paper_evidence | WBPaper00032446 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Genotype | muIs27[GFP::mig-2] | Paper_evidence | WBPaper00032446 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00039950 | |||||||
WBPaper00032446 | ||||||||
WBPaper00025842 | ||||||||
WBPaper00033081 | ||||||||
WBPaper00046151 | ||||||||
Method | Substitution_allele |