WormBase Tree Display for Variation: WBVar00000164
expand all nodes | collapse all nodes | view schema
| WBVar00000164 | Name | Public_name | amP11 | ||
|---|---|---|---|---|---|
| Sequence_details | SMap | S_parent | Sequence | F22A3 | |
| Flanking_sequences | tttgagtcacatatagataacacaattaat | atgcattaagttttcaaaattccttcatac | |||
| Mapping_target | F22A3 | ||||
| Type_of_mutation | Insertion | ||||
| SeqStatus | Pending_curation | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Laboratory | WU | ||||
| Detection_method | [Jakuboswki J] PCR and gel electrophoresis | ||||
| Positive_clone | F22A3 | ||||
| Status | Live | ||||
| Remark | [Jakuboswki J] Polymorphism is an insertion of approximately 300 base pairs in the RC301 strain at position 9021 of cosmid F22A3) | ||||
| [Jakuboswki J] Map = X | |||||
| [201021 pad] Generated flanks around position 9021-9022 of the F22A3) clone which is an T-A. | |||||
| Method | Allele |
