WormBase Tree Display for Variation: WBVar00000161
expand all nodes | collapse all nodes | view schema
| WBVar00000161 | Name | Public_name | amP8 | ||
|---|---|---|---|---|---|
| HGVSg | |||||
| Sequence_details | SMap | S_parent | Sequence | F22A3 | |
| Flanking_sequences | gtctagttcactgaaaaatgatatcaactt | aaaatcttccaccaagcatcatacaactta | |||
| Mapping_target | F22A3 | ||||
| Type_of_mutation | Substitution | A | T | ||
| SeqStatus | Sequenced | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Laboratory | WU | ||||
| Detection_method | [Jakuboswki J] DNA Sequencing | ||||
| Positive_clone | F22A3 | ||||
| Status | Live | ||||
| Affects | Gene | WBGene00017690 | |||
| Transcript | F22A3.5.1 | VEP_consequence | intron_variant | ||
| VEP_impact | MODIFIER | ||||
| Intron_number | 8/11 | ||||
| Genetics | Mapping_data | Multi_point | 3849 | ||
| Remark | [Jakuboswki J] Single nucleotide polymorphism (A to T) at position 18229 of cosmid F22A3 (nucleotides following polymorphism: AAAATCTTCC) | ||||
| [Jakuboswki J] Map = X | |||||
| [201021 pad] Generated flanks around position 18229 of the F22A3 clone which is an T. | |||||
| Method | Allele |
