WormBase Tree Display for Variation: WBVar00000141
expand all nodes | collapse all nodes | view schema
WBVar00000141 | Evidence | Paper_evidence | WBPaper00031911 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | am134 | ||||||
Other_name (2) | ||||||||
HGVSg | CHROMOSOME_V:g.8464780C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | T23B12 | ||||
Flanking_sequences | gatgatgctgaaaaactaagattcgaaaga | gattcgaaccattcgactcacttgggcctc | ||||||
Mapping_target | T23B12 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00045887 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00040584 | |||||||
Laboratory | WU | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00020719 | ||||||
Transcript | T23B12.4.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | T23B12.4.1:c.2071C>T | |||||||
HGVSp | CE29351:p.Arg691Ter | |||||||
cDNA_position | 2112 | |||||||
CDS_position | 2071 | |||||||
Protein_position | 691 | |||||||
Exon_number | 7/10 | |||||||
Codon_change | Cga/Tga | |||||||
Amino_acid_change | R/* | |||||||
Genetics | Interpolated_map_position | V | 1.41201 | |||||
Description | Phenotype | WBPhenotype:0001750 | Paper_evidence | WBPaper00031911 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals developed to adult stage on NAMM supplemental with 0.3mM or 0.22mM zinc, a concentration that causes almost 100% or 25%, respectively, of wild-type animals to arrest as L1 larvae. | Paper_evidence | WBPaper00031911 | |||||
Curator_confirmed | WBPerson712 | |||||||
Semi_dominant | Paper_evidence | WBPaper00031911 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Animals were cultured on Nobel agar minimal media (NAMM) with supplemental zinc sulfate starting at the egg stage, and development was monitored daily. | Paper_evidence | WBPaper00031911 | ||||
Curator_confirmed | WBPerson712 | |||||||
Temperature | 20 | Paper_evidence | WBPaper00031911 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000043 | Paper_evidence | WBPaper00031911 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00031911 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000520 | Paper_evidence | WBPaper00031911 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000648 | Paper_evidence | WBPaper00031911 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001206 | Paper_evidence | WBPaper00031911 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00031911 | |||||||
WBPaper00045887 | ||||||||
Method | Substitution_allele |